- How It Works
- PhD thesis writing
- Master thesis writing
- Bachelor thesis writing
- Dissertation writing service
- Dissertation abstract writing
- Thesis proposal writing
- Thesis editing service
- Thesis proofreading service
- Thesis formatting service
- Coursework writing service
- Research paper writing service
- Architecture thesis writing
- Computer science thesis writing
- Engineering thesis writing
- History thesis writing
- MBA thesis writing
- Nursing dissertation writing
- Psychology dissertation writing
- Sociology thesis writing
- Statistics dissertation writing
- Buy dissertation online
- Write my dissertation
- Cheap thesis
- Cheap dissertation
- Custom dissertation
- Dissertation help
- Pay for thesis
- Pay for dissertation
- Senior thesis
- Write my thesis
248 Popular Nutrition Research Topics That You Can Write About
A balanced diet can make you more productive in your tasks each day. However, how sure are you that the diet that you take is what is required? If you are doing a course in Nutrition and Dietetics, you need to do thorough research. There are certain steps you need to take before diving into the research work.
Characteristics Of A Good Nutritional Research Paper Topic
To prosper in your research, you need to find an ideal topic that won’t be too stressful for you.
Clarity of the topic: If you want to write a great nutritional research paper. The topic needs to be clear. This will make it easy to do the research and also others to understand what you are doing. It should be something common that people will be interested in, even taking part in the research or reading it. Well-defined research paper: The research paper topic needs to be well-phrased for successful research. The topic needs to be direct. So that even when someone tries to read it, they can conclude what the research should bring out. Simple language: If you want to prosper in your nutritional research. Just ensure that you use simple language that most people can understand. You are writing research so that people can benefit from it. There is no need to use too much complex language that won’t help anyone. Simple title: The title should follow the right procedure. It should be written perfectly. Also, ensure that your research aligns with your nutritional research topic. In the case that you want to research various used chemicals, try and stick to the topic as it is. The work: Ensure your research paperwork has an introduction, body, and conclusion. This is critical for any essay, research paper, or assignment
Nutrition Research Topics
Different farming practices lead to low or high production. The amount of food that you are consuming can have an impact on your overall weight. Here are some of the best nutrition research topics that you can start with.
- Evaluate some of the most common abdominal fat and health risks.
- The major causes of adolescent and childhood obesity or weight gain.
- The high risks of obesity in children. Which ingredients should be avoided?
- Evaluate the most common allergies and food sensitivities.
- The importance of maintaining child nutrition and health.
- Evaluate the digestive diseases and associated disorders
- Evaluate the disordered eating habits in different age groups.
- The best way to promote healthy eating and physical activity.
- The best intervention that can be put in place is to reduce obesity.
- Evaluate the best way to increase fruit and vegetable intake in different households.
- How can diabetes be reduced in different age groups?
- The best intervention ways to increase fruit and vegetable intake in the elderly.
- The best way to provide good nutrition is in rural public schools.
- Does coffee consumption help in stress reduction?
Informative Nutrition Topics to Write About
You need to provide high-quality work when submitting the research work to your professor. Here are some of the best informative nutrition topics to write about. You can even get some details in other scholarly articles.
- The impact of cooperative extension in diabetes education and how to carry out self-care.
- The common perceptions of students who eat organic food to health.
- The relation between BMI and waist circumference in health indications.
- The link between environment and dietary intake among rural teens.
- The relationship between emotional brain formation and weight variation.
- Factors that need to be considered when mothers are breastfeeding.
- The common reasons for low fidelity to education programs in patients with gestational diabetes.
- The best approaches to take when maintaining weight loss.
- The eating habits disorders among athletes.
- Evaluate the diet quality of university students.
- Evaluate celiac disease in individuals.
- The various perceptions about school feeding programs.
- The impact of obesity on the health of individuals.
- How can the media be used in providing nutrition education for individuals?
In-Depth Nutrition Research Paper Topics
If you want to write an amazing research paper, make use of the various resources. You can even get relevant information from documentaries, scholarly articles, books, pdf, and much more.
- The relation between cigarette consumption and weight loss.
- The perceptions of nutritional screening tools for the elderly.
- The effectiveness of school welfare policies.
- The parental perception of the nutritional status of children that have autism.
- The major causes of stress eating among the youth.
- The relation between healthy food and mental health issues.
- The relation between sleep and nutrition.
- How healthy eating impacts athletes’ performance.
- The impact of breakfast on someone’s productivity during the day.
- How social media impacts students’ dietary choices.
- The benefits of superfoods to our bodies.
- The rising popularity of the paleo diet.
- The major causes of various food addictions
- The relation between diet and someone’s moods.
Comprehensive Nutrition Research Questions
Are you looking for the best comprehensive nutrition research questions? You can start with these. They are also not that hard to understand.
- Which are the genetics that causes obesity?
- How do children’s eating disorders impact children’s dietary choices?
- The best way to prevent chronic diseases is through better food culture choices?
- Do you think overhydration is worse than dehydration? Give reasons
- Which are the major impacts of social media on women’s body image?
- Which is the relationship between hormones and nutrition?
- What are the risk considerations of the keto diet?
- Which are the best methods for improving physical fitness?
- Are the dietary fats good or bad?
- Which are the major roles of proteins in weight loss?
- How do diet trends affect human health?
- Do you think fasting can help in weight loss?
- Which are the bad eating habits that cause disorders?
- How to ensure proper nutrient intake in our day-to-day lives?
Interesting Nutrition Topics
Would you want some of the most interesting nutritional topics? Start with these! They are all based on common things that happen that you can easily relate to.
- The role of creatine in improving athlete’s performance.
- How a mother’s diet impacts the breast milk quality.
- The major symptoms of malnutrition among kids.
- The components that make GMO food.
- The major effects of thermal processing on nutrients.
- The factors that contribute to obesity among students.
- The various dietary differences between different income level households.
- The major foods that boost serotonin levels.
- The connection between the immune system and diet.
- The development of ketosis.
- The component found incomplete proteins.
- The different functions of minerals and vitamins.
- The negative effects of too many vitamins.
- The transformation of carbohydrates to energy.
Engaging Nutrition Topics For Presentation
Is your assignment meant to be made as a presentation? These are some of the best topics that you can use. They are all diverse and you will get all the required answers on books, pdfs, or any other credible source.
- How does nutrition impact one’s connective tissue strength?
- The major advantages and disadvantages of fats in our bodies.
- How do lipids make a meal feel satisfying?
- The difference between saturated and unsaturated fatty acids.
- The interrelations between vitamins and other food components.
- The influence of nutrition on hormones.
- The consequences of zinc deficiency on our bodies.
- The nutrients that help to improve your skin and hair.
- The function of amino acids on our bodies.
- Do you think you could survive on dietary supplements only?
- Compare the effectiveness of gummy vitamins and pills.
- The various ways that the body produces vitamin D from sunlight.
- The reasons behind more women suffering from anemia than men.
- What influences the presence of minerals in food?
Engaging Nutrition Essay Topics
Taking a balanced diet can help prevent you from getting these common nutritional diseases. Would you want to know more? Try any of these nutrition essay topics.
- Is there a difference between the health benefits of white and brown bread?
- The major benefits of cereals in our meals.
- The best substitutes for white sugar.
- The nutrients found in fresh and dried fruit.
- The versatile uses of coconuts and benefits to our bodies.
- Comparison between white and red meat.
- What components are in sugar that make it a good preservative?
- How does milk help in strong bone development in children?
- The pasteurization process of milk.
- Meat is a staple food in most cultures.
- The chemical compounds found in margarine and butter.
- The healthier alternatives to coffee.
- Does taking a glass of wine daily have health benefits at all?
- The major causes of hangovers in individuals.
Nutrition-Related Topics
What is the kind of food that you take? Are they beneficial to your body? These are some of the best nutrition-related topics that you can ever come across.
- The impact of food safety in different institutions
- Evaluation of nutrition in preschools for children.
- The positive and negative effects of training and nutrition on football players.
- The nursing habits of college-age students.
- The major effects of caffeine in tea and coffee that you take.
- The importance of eating a variety of foods.
- The most energizing foods for a healthy body.
- The major characteristics of multiple grain types.
- The factors that impact mineral absorption.
- The myth and facts behind the food pyramid.
- The major foods that belong to the legumes food groups.
- The advantages of taking various milk types.
- The importance of glucose on our bodies. How often should we take glucose?
- The major effects of selenium on health.
Nutrition Topics for Research
Research should be done systematically. First, you need to plan out how you are going to carry out the research. After you are done, be sure to start your research using different resources.
- The health benefits of non-digestible compounds.
- The major causes of lactose intolerance.
- Why is there an increase in eating disorders among female athletes?
- Which is the amount of protein that you need for muscle development?
- Do you think the time you eat is equally as important as what you eat?
- What is the importance of knowing your BMI?
- Evaluate whether the best way to overcome unhealthy emotional relationships is with food.
- How sleep regulates leptin levels in the body.
- The major causes of the prevalence of diabetes among college students.
- What are the major benefits of gummy vitamins?
- The various beliefs are accustomed to whole grains.
- The trends of breast cancer among women.
- Evaluate the various environmental contaminants globally.
- Why do you think people opt to be vegetarians?
Nutrition Presentation Topics
These are some of the best nutrition presentation topics that you can start with. They are simple, engaging, and straightforward. They will help you to make the best presentation you have ever made.
- How can you consider a certain food as being energizing? What criteria are used?
- The major characteristics of grains.
- The origins of potatoes in the ecosystem.
- The health benefits of avocados on our bodies.
- How do some foods work as home remedies?
- Which are the best ways to prepare scrambled eggs to ensure they provide full nutritional benefits.
- The impact of globalization on our diet.
- The different diet adaptations in different seasons.
- The positive impact of breast milk on infants.
- The dietary requirements for someone with HIV/AIDS.
- The best food to take when you want to lose weight.
- The major consequences of malnutrition.
- The major causes of celiac diseases.
- The advantages of organic food consumption.
- Can alcohol be considered to be part of a healthy diet?
Nutrition Topics For College Students
Are you in college and wondering where you will get the best nutritional topics for your course using? All these topics are ideal for that.
- The process of energy production from food nutrients in our bodies.
- Make a comparison of the heterotrophs and autotrophs feeding behavior.
- How is food converted to simpler substances in the body?
- The duration in which animals can convert complex food substances into simpler ones.
- How are proteins broken down in the body to be beneficial?
- How blood carries nutrients in the body.
- How high cholesterol levels can lead to body issues
- The importance of diet supplements to busy people.
- How does the body use electrolytes in the body?
- How certain diets expose people to cancer.
- Which is the best way to modify a diet to combat a certain disease?
- The role of nutritional knowledge in making informed decisions.
- The major causes of chronic diseases in human beings.
- The negative effects of depression on nutrition.
Engaging Topics In Nutrition
Nutrition is quite advanced. Both harmful and beneficial foods should be taken in moderation. These are some of the best engaging topics in nutrition.
- Which foods lubricate body joints?
- The importance of fats in hormone production in the body.
- Why do different fats have varying impacts on people’s bodies?
- The major roles of unsaturated fats in the body.
- The role of fats in preserving the health and brain development in humans
- The negative effects of being a vegetarian for too long.
- How does taking too much sugar cause diabetes?
- The major causes of allergies on people with health conditions?
- The importance of eating fiber-rich foods.
- What amount of water do adults have in their bodies
- The relation between eating and sleeping habits.
- How taking sugary foods leads to loss of memory and inactivity?
- How taking too many snacks is not healthy for the body?
Food and Nutrition Essay Topics
Are you planning to do an essay? These are some of the best food and nutrition essay topics that you will ever stumble upon. Always strive to eat a healthy diet at all times.
- The long and short-term effects of food on our health.
- How does water absorption occur in the body?
- Does weather impact the amount of water we can take in a day?
- The influence of weather on digestion.
- The negative influence of fast food selling hotels on some lifestyle diseases.
- The major determinants on whether an animal feeds on simple or complex inorganic compounds.
- How are nutrients converted into minerals?
- When should someone use a nutrient supplement?
- The impact of alcohol intake by pregnant women.
- Why do pregnant women crave different food?
- The necessary nutrients after doing a hard workout.
- The role of carbohydrates in an athlete’s body.
- The importance of energy management on brain development
- The importance of calcium to sportsmen and women.
- How good nutrition maintains a great athletics record.
Research Topics in Nutrition and Dietetics
When doing your thesis, you need to do thorough research to ensure that your professor will give you top grades. If you are doing a dietetics course, these topics will serve the purpose.
- How athletes can easily manage hunger cues.
- The role of Vitamins to people that engage in sports.
- The effect of chili on our bodies.
- Which are the best ways to deal with obesity?
- The disadvantages of obesity on children below 18 years.
- The social and economic effects of poor nutrition.
- How is healthy aging important for active aging?
- How nutrition determines the body’s immunity.
- The best way to make nutrition reforms & policies for the benefit of residents in different regions.
- The role of proteins in sustainability and health.
- The negative and positive impact of moods on eating well.
- The role of nutrition in determining a body’s immunity.
- Does ingredient dosage matter in food and nutrition?
- The role of misinformation on unhealthy eating habits.
- The myths related to plant-based proteins.
Popular Nutrition Topics
Are you supposed to choose the best nutrition topic for your assignment? Try any of these topics and see how knowledgeable you will become.
- The impact of food wastage in most developing nations.
- The impact of fasting on one’s health standards.
- How to maintain a healthy diet for the whole family at home.
- The role of nutrients on the central nervous system.
- How does caffeine affect athletes?
- How food contributes to an increase in BMI?
- The best foods to boost sports performance.
- How muscles help individuals in sports.
- The major roles of enhancing appetite.
- Why athletes should not drink a lot of water during exercise?
- How food choice can prevent some dietary diseases.
- Does babies’ nutrition impact their growth?
- The relation between genetics and nutrition.
- The major challenges faced in maintaining healthy eating habits.
Ideal Nutrition Thesis Topics
When given a writing task, it can be hard to know where to start. However, teachers don’t quite require a lot from students. Just try to do what you can and give it your best shot.
- The best eating habits that you can embrace.
- The difference between red and white meat.
- Evaluate the milk pasteurization process.
- The advantages of milk consumption every morning.
- The various beneficial components found in milk.
- What are the best foods that the elderly should take?
- How eating patterns affect the sleeping pattern.
- The major causes of different eating patterns.
- The effects of homemade food and intuitive eating habits.
- The nutritional problems for pregnant women.
- The relation between income and nutrition.
- The major evidence-based nutrition.
- Evaluate nutrition and blood pressure.
- The advantages of organic food consumption
Health and Nutrition Topics
Our health plays a huge role in how effective we can be on different tasks. If you are fatigued or hungry, it can have adverse effects on your body.
- How is nutritional profiling used?
- The point of counting calories found in the body.
- The major health benefits of vitamin water.
- Why does the younger and older generation require different nutrition?
- The major methods of projects that promote proper nutrition.
- The relation between diet and one’s moods.
- The major causes of teenagers developing an unhealthy attitude towards food.
- The role of hunger and control in anorexia.
- How malnutrition can cause an issue with an unborn child.
- How poor eating habits lead to physical conditions.
- The best way to maintain an active lifestyle for proper health.
- The biological factors surrounding eating disorders.
Sports Nutrition Topics for Research
These are some best sports nutrition topics for research that you can start with. You can use them for your homework, assignment, thesis, or dissertation.
- How different food varieties help athletes.
- The role of carbohydrates in the mental development of athletes.
- Explain the water cycle in an athlete’s diet.
- Why do athletes need calcium?
- How does trans-fat affect an athlete’s performance?
- The importance of supplements in the diet.
- How supplements and diets help in weight management.
- What capacity of food should athletes eat before and after training?
- The amount of water athletes should take before and after running.
Requiring Help With Your Nutrition Dissertation?
Are you looking for the most ideal writing service assistance? We provide nothing but the best. We have expert writers that will ensure you get custom work at an affordable price. All the planning is done online to ensure your work is delivered on time. Whether you are in university or college, these topics will help you.
Leave a Reply Cancel reply
Your email address will not be published. Required fields are marked *
Comment * Error message
Name * Error message
Email * Error message
Save my name, email, and website in this browser for the next time I comment.
As Putin continues killing civilians, bombing kindergartens, and threatening WWIII, Ukraine fights for the world's peaceful future.
Ukraine Live Updates
Top Nutrition Research Paper Topics for Students
Table of contents
- 1 Nutrition Research Topics for College Students
- 2 Interesting Nutrition Topics for Research Paper
- 3 Research Topics in Nutrition and Dietetics
- 4 Sports Nutrition Topics for Research
- 5 Nutritional Responses to the COVID-19 Pandemic
- 6 Advances in Food Technology and Biotechnology
- 7 Emerging Topics in Nutrition and Health
- 8 Innovations in Food and Dietary Patterns
- 9 Climate Change and Nutrition Research Topics
- 10 Other Popular Nutrition Paper Topics
- 11 Conclusion
Sometimes, coming up with an interesting topic is much more challenging than even writing a 10-page essay. After all, there are so many unique themes you could divulge, and choosing the only one that would suit your needs best can be overwhelming.
To narrow down your list of potential nutrition topics for research, it’s in your best interest to start with broader themes that spark your interest. For example, do you want to know more about how food impacts health and disease? Are you more interested in the psychological and emotional connection to food? Perhaps you’ve always been curious about nutrition and muscle development or weight loss?
Once you have a general direction, you’d like to go in, and finding suitable topics becomes much easier.
But if you’re still struggling with finding inspiration for your next essay, you should check out PapersOwl’s nutrition research paper topic suggestions. We’ve compiled a list of dozens of unique topics that’ll help you finish your assignment.
And if you need more than just suggestions, you can always find nutrition and nursing papers for sale on our platform.
Without further ado, let’s get into some of the best topic ideas!
Nutrition Research Topics for College Students
The following are some of the best nutrition research paper topics for college students who want to learn more about the themes that directly affect them. In case you need assistance with writing any of the following topics, you can order custom research papers and receive authentic, plagiarism-free content written by nutrition experts.
- Stress eating a growing problem among college students
- The cause and effects of Freshman 15
- How healthy foods can help deal with mental health issues
- Sleep and nutrition –how they relate to each other
- How healthy eating impacts a college athlete’s performance
- Is breakfast the most important meal of the day?
- Why women are more likely to suffer from anemia
- Preventing/curing hangovers with smarter food choices
- The impact of social media on students’ dietary choices
- What are superfoods, and can they be beneficial?
- The rising popularity of the paleo diet
- What makes fast food so addictive?
- Most common eating disorders among college students
- Diet and mood – how they’re intertwined
- Can healthy foods improve cognition and brain power?
Interesting Nutrition Topics for Research Paper
If you’d prefer a bit more exciting topic that encourages debate and gets your readers immersed, take a look at the following nutrition research paper topic suggestions.
- Overcoming unhealthy emotional relationship with food
- The intricate relationship between smoking and weight
- How sleep moderates ghrelin and leptin levels
- Cannabinoids as nutritional supplements
- Prevalence of diabetes among college students
- How helpful are gummy vitamins?
- Genetic predispositions for becoming obese
- How parents’ eating habits impact children’s dietary choices
- Preventing eating disorders in teens and young adults
- How the body positivity movement can be harmful to young adults
- In-depth review of US school lunches – what needs to change?
- Preventing chronic diseases with better food choices
- Is overhydration more dangerous than dehydration?
- The impact of social media on women’s body image
- Hormones and nutrition – how are they connected?
- Community health initiatives and their impact on nutrition
Research Topics in Nutrition and Dietetics
Analyzing diets and their impact on our health and fitness is always intriguing. Learn more about nutrition and dietetics with some of the following nutrition research topics:
- Keto diet and risk considerations
- Dietary changes during the COVID-19 pandemic
- Nutrition vs. physical activity for healthy weight management
- Methods for improving physical fitness while limiting calorie intake
- In-depth analysis of yo-yo dieting
- How going vegan impacts health
- Dietary fats – the good and the bad
- The dark side of the juice cleanse
- The role of proteins in weight loss
- How popular diet trends affect your health
- Is intermittent fasting a good way to lose weight?
- In-depth analysis of compulsive eating disorder Pica
- Harmful trends that promote eating disorders
- How to ensure proper nutrient intake on a plant-based diet
- Are vegan foods always healthier?
- Staple food: its role in global nutrition and dietary guidelines
Sports Nutrition Topics for Research
Student-athletes always want to know more about how food and nutrition impact their performance. The following topics can be just as useful to them as they are to med students.
- Prevalence of eating disorders among female athletes
- How plant-based diets impact athletes’ performance
- How much protein you need for optimal muscle development
- The role of BCAA’s in weightlifting performance among seniors
- Is when you eat just as important as what you eat?
- The impact of food choices on muscle recovery
- Maintaining electrolyte balance during endurance training
- The role of creatine in improving athletic performance
- How to safely cut weight ahead of a competition
- Effects of dietary fibers on carbohydrate uptake and absorption
- What athletes need to know about BMI
- Most effective supplements for bone and tendon health in combat athletes
- How caffeine impacts athletic performance
- In-depth analysis of Peri-Workout nutrition for strength athletes
- Examining the effects of low-carb diet trends on athletic performance
- Nutritional contributions to bone health and prevention of osteoporosis
Nutritional Responses to the COVID-19 Pandemic
- The role of diet in modulating immune response during COVID-19
- Impact of nutritional status on COVID-19 outcomes
- Dietary interventions to reduce COVID-19-related inflammation
- Changes in physical activity levels due to pandemic restrictions
- Nutritional strategies to support at-home workouts
- Psychological impact of reduced sports activities and nutritional adjustments
- Disruptions in food supply chains during the pandemic
- Adaptations in dietary habits due to food shortages and lockdowns
- Long-term implications of pandemic-induced dietary changes on health
- Vitamin D deficiency: causes, effects, and solutions
Advances in Food Technology and Biotechnology
- Cellular Agriculture: Biotechnology for Sustainable Food
- Innovations in lab-grown meat production
- Environmental benefits of cellular agriculture
- Consumer perceptions and acceptance of cultured meat products
- Application of Nanotechnology in Food Science
- Enhancements in food safety and quality through nanotechnology
- Nanoparticles in food packaging for extended shelf life
- Potential health risks and regulatory challenges of nanotechnology in food
- Sustainable Food Production Through Biotechnology
- Genetic modifications for improved crop yield and nutrition
- Biotechnological approaches to reduce food waste
- Role of biotechnology in addressing global food security
- Healthier alternatives to common high-calorie foods
Emerging Topics in Nutrition and Health
- Potential benefits of cannabinoids in managing chronic diseases
- Use of cannabinoids as nutritional supplements
- Regulatory and safety considerations in cannabinoid use
- Benefits of human milk for preterm infants
- Challenges in breastfeeding preterm babies
- Strategies to enhance the nutritional quality of human milk
- Dietary approaches to promote muscle health across the lifespan
- Role of proteins and supplements in muscle maintenance
- Impact of nutrition on muscle recovery and performance
- Food addiction: understanding and addressing the issue
- The Mediterranean diet: benefits and implementation
Innovations in Food and Dietary Patterns
- Technological advancements in cultured meat production
- Economic and ethical considerations
- Consumer acceptance and market potential
- Health benefits of a predominantly plant-based diet with occasional meat
- Environmental impacts of flexitarian dietary patterns
- Strategies to promote flexitarianism among different populations
- Interactions between diet, gut microbiota, and health
- Personalized nutrition plans based on gut microbiome analysis
- Future prospects for microbiome-targeted dietary interventions
- The ketogenic diet: benefits, risks, and long-term effects
Climate Change and Nutrition Research Topics
- Impact of climate change on global food security
- Sustainable agricultural practices to combat climate change
- Policy frameworks for climate-resilient food systems
- Promoting plant-based diets for environmental sustainability
- Reducing food waste through dietary changes
- Integrating nutrition and sustainability goals in public health policies
- Effects of thermal processing on nutrient retention
- Innovations in food processing to enhance nutritional value
- Consumer education on processed food and health
- The rise of organic food: benefits and challenges
Other Popular Nutrition Paper Topics
Miscellaneous topics can often be some of the most interesting ones, especially since few students ever opt for them. Browse through these ten unique topics and choose the one that suits you best.
Once you’ve found a great topic, writing becomes a much easier task. But if you can’t find the time for your paper, a quick search for services that can “ write my research paper for me ” could be a God-send.
- Infant brain development and nutrition
- How a mother’s dietary choices impact the quality of breastmilk
- Symptoms of malnutrition among children
- Immune system and diet – how they’re connected
- The real science behind GMO food
- The effects of thermal processing on nutrients
- Factors contributing to obesity among young Americans
- Different nutritional needs among different age groups
- Dietary differences between low-income and high-income households
- Foods that boost serotonin levels
- Strategies to prevent eating disorders in adolescents and adults
- Examining the impact of different dietary practices on health
- The importance of dietary fiber in maintaining digestive health
- Effective dietary strategies for managing chronic diseases
- Addressing childhood obesity through better nutrition
- The impact of fast food consumption on public health
- Analyzing health claims on food labels and their accuracy
Food Safety and Packaging Innovations:
- Biodegradable packaging materials composed of natural polysaccharides
- Ensuring safe infant formula and baby food
- Analytical strategies for the determination of microplastics and emerging migrants from packaging in food
Nutritional Strategies for Disease Prevention and Management:
- Ketogenic metabolic therapies in prevention & treatment of non-communicable diseases
- Nutritional strategies and diet-microbiota interaction to improve skeletal muscle function
- Exploring nutrition to mitigate the negative effects of air pollution
- Functional foods for metabolic health
- Nutritional management of patients with inborn errors of metabolism
Gut Health and Microbiota:
- Dietary modulation of gut microbiota-x axis
- Efficacy of probiotic-enriched foods on digestive health and overall well-being
- Effects of probiotics, prebiotics, and postbiotics on microbiota-gut-brain axis
Bioactive Compounds and Nutraceuticals:
- Food derived bioactive metabolites: Unlocking their potential health benefits and medical potential
- Phenolic compounds in a circular economy: Extraction from industrial by-products and wastes, potential activity and applications
- Advances in sulfated polysaccharides and precision nutrition
- Immune cell metabolism beyond energy supply – An emerging era to showcase novel roles in immune effector functions
Marine and Aquatic Nutrition:
- Processing and utilization of marine food resources
- Quality and flavor changes in aquatic products
- Seaweeds as a promising alternative protein source for the sustainable world
Pediatric and Maternal Nutrition:
- Peptide in promoting lactation and infant development
- Innovative approaches to nutrition counseling in pediatric dietetics – Guidelines, practices, and future directions
- The first 1000 days: Window of opportunity for child health and development
Advances in Dietary Supplements:
- Advancements in dietary supplements: Enhancing sport performance and recovery
- Marine peptides in regulation of bone immunomodulation, bone joint and other bone-related disease
Environmental and Sustainable Nutrition:
- Food system transformation and the realization of the UN sustainable development goals
- Advanced nutritional research driven by artificial intelligence
Processing and Preservation Technologies:
- New developments in low-temperature food preservation technologies: Safety, sustainability, modeling and emerging issues
- Storage and deep-processing of fruit and vegetable products
- Recent advances in quality control technology for fresh fruits and vegetables
Exploring the ways how human bodies work and react has interested people for thousands of years. No wonder there are a lot of engaging dietary and nursing research topics for modern students to choose from. You’ve already got acquainted with 70 of our top nutrition topics for research papers, so gather inspiration from our list and get started with your essay!
If you need further assistance with your writing, PapersOwl’s experts are available 24/7. Contact us, and place your order for custom nutrition papers.
Readers also enjoyed
WHY WAIT? PLACE AN ORDER RIGHT NOW!
Just fill out the form, press the button, and have no worries!
We use cookies to give you the best experience possible. By continuing we’ll assume you board with our cookie policy.
65 Nutrition and Dietetics Topics For Research
Topic Ideas
Dear Readers, In this blog post I am sharing a list of various examples of titles and topic ideas for research projects in both qualitative and quantitative approaches to nutrition thesis and dietetics.
Examples of nutrition and dietetics thesis topic ideas:
- Promotion of healthy eating and physical activity: a qualitative examination of obesity interventions based on the community of Corona.
- Promote health for family members with home-cooked meals: Evaluation of a social marketing program aimed at low-income mothers.
- Pilot nutrition and intervention plan to increase fruit and vegetable intake among older adults participate in the healthy grandfather program.
- Evaluation of Diabetes in self-management of the program for Hispanics in countries with few possibilities of public health policies.
- Nutrition intervention of the color plate: Using exposure interventions to increase the consumption of fruits and vegetables in the elderly.
- Comparison of rapid methods to determine body composition in university athletes and obese women.
- Provision of good nutrition in rural public schools.
- Evaluation of the composition of the pediatric cancer survivor diet as a need for nutrition.
- Stress perceived, caffeine consumption and an average of undergraduate students in a large public university.
- Associations between the consumption of fruits and vegetables among the biggest consumers and farmers in the market.
- Factors of food safety affect growth in young children in an indigenous community.
- Nutritional evaluation of preschool children in an urban community.
- The perceptions, knowledge, advantages, and obstacles of Hispanics with respect to dietary guidelines for Chileans.
- The effect of training and nutrition on the body composition of college football players.
- Consumption of fruit and vegetables of the Division I collegiate football and volleyball players pre and nutrient deregulation.
- Nursing habits and knowledge of college-age students.
- The role and impact of cooperative extension in diabetes education in self-care.
- Perceptions of students who eat organic food in relation to health, environment.
- The relationship between BMI and waist circumference, weight loss, health indicators.
- Link to home and neighborhood food environments regarding dietary intake among rural teens.
- Impact of the law of healthy children and without changes in the phytochemical content of school lunch menus and the implications of education based on the science of nutrition in the promotion of student identification of food rich in phytochemicals.
- Explore the relationship between emotional brain formation, stress, depression, food addiction, and weight.
- Study abroad opportunities for students of human and dietetic nutrition: Expectations, benefits, and barriers.
- Factors in the initiation of breastfeeding.
- Promote healthy, homemade food: formative research for a healthy eating program.
- Farmers and their shopping behaviors and the Association of fruit and vegetable intake.
- Examine the reasons for low fidelity to educational programs in patients with gestational diabetes: a qualitative study.
- The effect of a nutrition education program on the performance of knowledge of nutrition, diet, body composition and perceived sport among athletes.
- Cortisol, physical activity and weight loss in a randomized clinical trial.
- Exploring new approaches to maintaining weight loss: Eat intuitive and emotional.
- Habits of food purchases and association with diet.
- Disorders of eating habits and behaviors among university athletes.
- Entrepreneurship: Perceptions of Chile’s growers and benefits of barriers.
- The overall quality of the diet of university athletes.
- Practical management of adult low-income adults food and feeding behaviors and the association with diet.
- Celiac disease: a gluten-free diet and the quality of the diet.
- Optimal feeding program for future elite athletes.
- Evaluation of the corporal composition of university athletes.
- AN analysis of the influence of nutrition information on menu options of the consumer’s restaurant.
- Cross-cultural Comparison of perceptions about school feeding programs.
- Obesity related to perceptions and practices among educators in food and nutrition-
- Perception and use of electronic media streaming video in nutrition education for individuals.
- Knowing the nutrition of consumers and health professionals and the use of calories from the labeling menu.
- Knowledge, attitudes and beliefs regarding whole grains.
- Conditions chronic health of people in public housing.
- Practice and application of knowledge by nutrition students.
- Evaluation of the natural antimicrobial phenolic compounds against food pathogens.
- Trends of breast cancer among women in Chile.
- The healthy Monday campaign: On health in elementary schools.
- Evaluate the perception of environmental contaminants, health and nutrition behavior to improve risk communications.
- THE association between emotional intelligence, body mass index and eating behavior among university students.
- The characterization and calculation of the quality of the diet of a low-income population in Chile.
- Vegetarians and VEGAN in UK.
- Impact of a week 16 behavior-weight loss program changes physical activity and diet.
- Relationship between cigarette consumption and weight loss.
- Examine the relationship between quality of weight, food insecurity, food stamps and perceived diet in children of school age.
- Use and perceptions of nutritional screening tools for the elderly.
- The prevalence of nutritional problems in L.A women living in affordable housing.
- Intake of nutrients and medications of children with neuro-developmental disorders.
- The effectiveness of school welfare policies.
- A descriptive study of diet and physical activity practices of overweight and obese students of the University enrolled in a weight loss program.
- Challenges and opportunities for rural nutrition education programs in communities of corona.
- Parental Perception of the nutritional status of children with autism.
- Comparing the nutritional intake of home school children and public school children: A comparison study.
- Regional differences and associations with factors related to obesity in overweight and obese Americans.
Related Posts
116 Thesis Topics in Administration
95 Architecture Thesis Topics
133 Thesis Topics for Social Work
494 Nutrition Research Topics & Interesting Essay Titles on Food for Students
A wise man once said that your food can be the slowest killing poison or the most powerful and safest medicine. This adage underscores nutrition’s supreme place in human health and life. Composing a paper on this topic can be of great value to you. That’s because you’ll get the chance to learn about the centrality of nutrition, evaluate diets, analyze food’s nutritional contents, and raise public awareness of food issues.
In this article, our expert team has assembled the best topics that can guide your research of this subject in depth and excel in your next nutrition research paper.
🔝 Top 10 Nutrition Topics in 2024
🧑🔬 what is nutrition science, 🔎 nutrition research topics, 🥑 nutrition science topics, 😋 nutrition essay topics, 🍲 nutrition topics for presentation, 🥫 more interesting nutrition topics, 🔗 references.
- Is mother’s milk the best choice for the baby?
- Nutritional approaches for low birth weight.
- Causes of malnutrition in older adults.
- Nutrition and allergy prevention.
- The role of breastfeeding in healthy child development.
- Good diet and gut health.
- Nutrition and human immunity.
- Malnutrition and brain development.
- Diets for people with gastrointestinal disorders.
- The role of malnutrition in premature aging.
Nutrition science is an academic branch that examines how food affects our well-being and health. It also determines the optimal levels of vital nutrients and elements we receive from food. Nutrition scholars examine foods, food groups, and intake patterns. This field seeks to explain how healthy eating boosts people’s overall mental and physical performance.
A nutrition scientist also engages in research work to expand and refine our understanding of the relationship between healthy life and diet. They guide people on good eating and develop education programs and public health policies to help communities make wise food choices .
All health experts in other spheres require a sound understanding of nutrition. Why? Because good eating can help prevent and treat most known diseases. Thus, a Nutrition major can be an excellent choice for those pursuing health-related professions.
Are you stuck with your nutrition research assignment? Here are popular topics for 2024 to talk about in your next nutrition assignment.
- Obesity and weight: what does nutrition have to do with it?
- Omega-6 fatty acids: exploring their nutritional value.
- Do organic foods offer superior nutritional value?
- Nutrition: Foods Containing Calories .
- Osteoporosis: how does good nutrition prevent it?
- How can good nutrition address chronic obesity among teenagers ?
- Sufficient hydration: its hidden role in promoting health.
- Nutrition: Fighting the Childhood Obesity Epidemic .
- A healthy diet as the best way to achieve safe weight loss.
- Whole grains and their nutritional value.
- Saturated fats and their role in nutrition.
- Nutrition and Food Security within the Aboriginal and Remote Communities of Australia .
- Soft drinks: a malnutrition time bomb.
- The role of misinformation in promoting malnutrition .
- Multivitamins and their nutritional value.
- Nutrition: Why Is Healthy Eating Important?
- Food labeling and user nutritional safety.
- Food poisoning and how it affects good nutrition.
- Food safety and its role in promoting healthy diets.
- Nutrition: Obesity Epidemics in America .
- Technology: how is it accelerating nutrition science?
- Eating disorders : their role in malnutrition.
- Fruits and vegetables: their role in nutrition-based immunity.
- Nutrition, Healthy Food Choice, and Nutritional Value of Fast Foods .
- Fast Food and Obesity Link – Nutrition.
- How does good nutrition boost heart health?
- High-protein diets and healthy living.
Topics in Clinical Nutrition
Clinical nutrition is a scientific practice that analyzes whether a person consumes enough nutrients for healthy living. Here is a list of our carefully selected hot clinical topics for college students.
- Food chemistry and good nutrition.
- High-Risk Nutritional Practices .
- How does a sound food policy promote clinical nutrition?
- How does technology affect nutrition?
- Nutritional Requirements During Pregnancy .
- Nutrition and metabolism : what’s the connection?
- Nutrition support action and in-patients in the US.
- The Roles of Nurses in Providing Nutrition Safety .
- Gut microbiome: how does it affect health and disease prevention?
- Effects of probiotics on the common cold and flu.
- Probiotics and diarrhea management in children.
- Nutrition and Obesity: Management and Prevention .
- Nutrition and its effects on antioxidation.
- Good diet and its effects on child diarrhea management .
- Investigation of nutritional screening and its benefits for older adults.
- Childhood Obesity Prevention: Physical Education and Nutrition .
- Pediatric nutrition screening among children in the developing world.
- Nutrition status assessment and its benefits for children.
- Challenges facing African nutrition professionals.
- Eating Disorders: Why Do We Need to Control Our Nutrition?
- Nutrition experts and their role in promoting public health.
- The role of training in promoting nutrition professionals’ efficiency.
- Coronavirus and Nutrition .
- Challenges facing nutrition education in the developing world.
- The elusive work-life balance among American nutritionists.
- Nutrition Research with Reference to Colorectal Cancer .
- Good nutrition and stress management.
- Nutritional challenges facing child refugees.
Research Topics in Nutrition and Dietetics
Dietetics applies nutrition and good feeding knowledge to understand and promote health and wellness among individuals and groups. Dietitians help people make informed eating decisions.
Here are cool topics to jumpstart you.
- Keto diet : exploring its potential risk factors.
- Dietary changes during pregnancy.
- Healthy Food: the Impact of the Vegetarian Diet .
- Improving physical fitness while limiting calorie consumption.
- How does a vegan diet affect your life?
- Normal Dieting and Eating Disorders .
- Dietary fats: unmasking their good, bad, and ugly sides.
- How do proteins help with weight loss?
- Juice cleansing: does it really work?
- Obesity Treatment: Surgery vs. Diet and Exercises .
- Contemporary diet trends and their effects on your health.
- Harmful lifestyle trends promote eating disorders.
- Fad Diets’ Impact on Human Health: Problem Solution .
- Ensuring proper nutrient intake on a vegan diet.
- Vegan foods: are they always the healthiest?
- How to overcome unhealthy emotional connections to food ?
- Non-Vegetarian Diet and Its Health Effects .
- Cannabinoid nutritional supplements: their hidden benefits and downsides.
- Diabetic prevalence among American teenagers.
- Weight Loss, Calories, Diet and Physical Exercising .
- Obesity and its connection to nutritionists’ perceptions and practices.
- Technology’s role in promoting nutrition education .
- Benefits of a Plant-Based Diet .
- The role of good feeding in managing terminal illnesses.
- Nutritional challenges facing ghetto dwellers.
- Eating Habits and Dietary Acculturation ,
- Nutrient and medication intake among children with neuro-developmental disorders.
- Good diet as a tool for reducing teenage obesity.
- Analysis of the Mediterranean Diet .
Nutrition and Exercise Research Topics
A balanced diet and physical activity are two pillars of human well-being. Moreover, healthy nutrition is essential for athletes because it promotes sufficient energy levels and accelerates post-exercise recovery . Below, you’ll find engaging topics about nutrition and exercise for high school students.
- A balanced diet and heart disease prevention.
- Diet and Exercises in Muscle Mass and Weight Loss .
- The role of nutrition in managing cardiovascular diseases.
- How do regular exercise and balanced nutrition reduce age-related degenerative diseases ?
- Obesity, Diet Modification and Physical Exercises .
- How do exercise and healthy food choices improve neurological function?
- How does a vegan diet lower cancer risk ?
- The Effectiveness of Diet and Exercise Therapy .
- Why are eating disorder rates increasing among female athletes?
- How does a vegan diet boost sporting performance?
- Exercise Stage and Decisional Balance in Overweight People .
- How much protein do you need for optimal muscle development?
- Can exercise and a balanced diet minimize heart attack risks?
- Nutrition and Exercise Plan for a Healthy Lifestyle .
- Can regular exercise and good nutrition eliminate cancer risks?
- The importance of meal timing for athletes.
- Physical Exercises as Obesity Treatment .
- Do your food choices affect muscle recovery ?
- Problems caused by excessive exercise and dieting.
- Nutrition and exercise: how much is too much?
- Physical Exercise for Adolescents .
- How to maintain electrolyte balance during endurance workouts?
- How does creatine improve athletic performance?
- Safe weight cut ahead of competitive games.
- Cardiovascular Diseases: Effects of Diet and Exercise .
- How do dietary fibers affect carbohydrate uptake and assimilation?
- How does caffeine affect athletic performance?
- The Role Exercise Plays in Diabetes Prevention .
- How do physical environments affect eating behaviors?
Other Nutrition Research Questions
Do you want the best topics about nutrition trends and technology? Here is our list of current ideas to research and write about.
- Are fermented foods sustainable protein alternatives?
- Nutritional Support During Pregnancy .
- How can green technologies be used for bioactive compound extraction?
- What are alternative protein sources for sustainable nutrition?
- Carbohydrates’ Role in Nutrition .
- What innovative technologies are used for producing high-quality proteins?
- How can AI technology advance food science ?
- How can solar drying technologies be used for food preservation?
- Nutrition: Causes and Effects of Fast Food .
- What are AI applications in postharvest food management?
- What bio-preservation approaches can be used in sustainable food processing?
- Healthy Nutrition for Vulnerable Aging Population .
- What is the role of AI in promoting safe food packaging ?
- What non-thermal technologies can be used for food preservation?
- Nutrition, Disease, and Malnutrition .
- How is ethics involved in developing new food processing technologies?
- What is the role of consumer behavior in developing a sustainable food chain?
- What challenges are linked to food preservation in the developing world?
- Factors Affecting Nutritional Intake .
- How do we minimize postharvest food loss in developing nations?
- What strategies can boost food waste management in the developed world?
- Healthy Nutrition Policy within a Workplace .
- What are edible oil extraction challenges in Asia?
- How can we reduce microbiological risks in food processing ?
- How can we ensure safe food preservation?
- Nutritional Supplements, Weight Loss Plans and Working Out .
- Nanotechnology and food production: what are the risks?
- What are trending sustainable food processing technologies in Asia?
- Nutrition Research: Grapefruit Diet for Weight Loss .
Here are some more handpicked nutritional food topics to inspire your essay.
- Safe food flavor manufacturing technologies.
- Technological advances in food coloring.
- Food Science: How to Make Butter .
- The latest food safety technologies that could boost food security in Africa.
- Food irradiation: how safe is it?
- Genetically Modified Foods and Their Impact on Human Health .
- How does microbiology improve food safety?
- What are nutraceutical products?
- Food Safety: A Policy Issue in Agriculture Today .
- Describe the process of extracting essential oils from plants.
- Does heat-based food processing reduce food’s nutritional value?
- Healthy Food in U.S. Schools .
- GMO foods : Are they as safe as they sound?
- How does food enriching differ from fortifying?
- Nutrients: The Distribution in the Food Groups .
- Describe how the food industry uses enzymes .
- How does food science improve the diet of older adults?
- Nutrition and disease prevention: challenges facing developing nations.
- Dietary Macronutrients: Importance and Benefits .
- How does good nutrition promote chronic liver disease management?
- The role of dietary proteins in promoting insulin resistance.
- Microbes and their role in promoting nutrient utilization for healthy living.
- Macronutrient Intake for a Day and Its Effect .
- Does dietary nitrate promote or undermine health?
- Expedition nutrition: common challenges and their solutions.
- Healthy and Nutritious Food for Young Children .
- Sustainable food: what are its nutritional dimensions?
- Fatty acid metabolism and immunity : how can the health sector help?
Sports Nutrition Topics
Here are some trending sport nutrition topics for discussion in your upcoming project.
- Creatine: how can it boost sports performance?
- Important Dietary Considerations for Endurance Athletes .
- Healthy eating and weight management.
- How do dietary supplements impact healthy bones and tendons during combat sports?
- Nutrition and Performance: The Effects of Nutrients on the Health of Endurance Athletes .
- The best nutrients for recovery from sports injuries.
- Body fluid balance after intensive sporting activities.
- A pragmatic approach to bicarbonate loading and sports performance.
- High Nutrition Diet and Its Harm to Athletes .
- A milkshake as a post-sporting recovery drink among young athletes.
- What is the role of food supplements in promoting effective sports activities?
- Nutrition and Hydration for Young Athletes .
- Food supplements and doping: Where should athletes draw the line?
- Does caffeine impact physical resilience?
- How does milk consumption boost athletic endurance?
- Coaches’ Role in Athletes’ Nutrition and Mental Health .
- How does a vegan diet influence athletic performance?
- What’s the effect of nutrition on blood volume during sports?
- Sports Nutrition: High-Protein Diet .
- How should athletes manage their hunger?
- The role of calcium in athletic performance.
- The benefits of a high-carbohydrate diet for athletes.
- Poor Nutrition: Impact on Poor Sports Performance .
- Fruits and vegetables: how do they provide energy for athletic activities?
- Water: exploring its hidden role in promoting successful sporting.
- Sports Nutrition Strategies for Triathletes .
- Sports drinks: How do they boost energy during long training sessions?
- Dietary supplements : their invaluable role in injury healing.
Food and Nutrition Topics
Wondering how specific foods and nutrients affect our health? Check out inspiring sample ideas for your paper on this subject.
- How do minerals and vitamins differ in their functions?
- Pizza as One of the Most Popular Food in London .
- The consequences of excessive protein intake.
- Effects of excess sugar in your body.
- Packaging in Marketing, Food Safety, Environment .
- Describe the consequences of dehydration on mental health and focus.
- Explain why glucose is vital to good health.
- Food Safety Issues in Modern Agriculture .
- Describe the circumstances that necessitate vitamin supplement use.
- Explain how ketosis develops in the human organism.
- Fast Food and Obesity Link – Nutrition .
- Explain why some people are intolerant to lactose.
- Describe the benefits of fats in promoting overall health.
- Time and Food: Chrononutrition & Night Eating .
- Differentiate between saturated and unsaturated fatty acids .
- Cholesterol: should people refrain from it or control its intake?
- Food Allergies and Eating Disorders .
- Explain the role of zinc in promoting sound health.
- Health dangers of depending on dietary supplements.
- Why is healthy food the best medicine?
- Sustainable Food Systems, Nutrition .
- Explain vitamin C’s role in neutralizing free radicals.
- Explore how inappropriate cooking methods destroy food nutrients.
- Advantages and Disadvantages of Biotechnology in Improving the Nutritive Value of Foods .
- How does red raspberry consumption boost the body’s anti-inflammatory potential?
- Does eating a fruit-based diet promote insulin action in people?
- Junk Food and Children’s Obesity .
- Describe how strawberries help lower cholesterol levels.
- Health dangers of consuming overly processed carbohydrates .
Health and Nutrition Topics
Nutrition has an immense impact on our health. If you want to explore this relationship in more detail, check out the most inspiring ideas to kick-start you.
- Strategies for assessing the antioxidant potential of fruit drinks.
- Healthy Eating Habits .
- Processed and unprocessed fruit beverages: which ones are healthier?
- Examine the cleansing potential of fresh juice .
- Problems Associated with Unhealthy Eating Among Children .
- Explain how nutrition influences healthy hormonal balance.
- How does the body convert sunlight into vitamin D ?
- Does poor nutrition cause baldness?
- Healthy Nutrition During Pregnancy .
- Describe how a good diet promotes healthy hair growth.
- Is a vegetarian diet a healthy choice for children ?
- Explain how a healthy diet promotes natural body detoxification.
- How does healthy eating prevent cognitive decline?
- Healthy Food Access for Poor People .
- How does good nutrition facilitate body immunity?
- Healthy Eating Advertising in Canada .
- Why does excess sugar consumption cause health problems?
- How does good nutrition facilitate digestive health ?
- Explain how chronic diseases influence nutritional health.
- Snacks and Beverages: Healthy Alternatives for Kids .
- Why are micronutrients vital in boosting good health?
- Explain how poor diet choices promote lifestyle diseases.
- Addressing a Healthy Diet at Home .
- Does crop engineering promote or undermine human health?
- How to prevent macronutrient and micronutrient deficiencies?
- Healthy Fast Foods: Sector Analysis .
- Accurate food labeling and dietary choices.
- The role of anti-inflammatory diets in managing chronic diseases.
- A Persuasive Speech: The Importance of Eating Healthy.
Animal Nutrition Topics
Wondering about the influence of nutrition on animals? Here are nutrition research paper topics in food and animal health .
- The role of good feeding in boosting rabbit health.
- A balanced diet and its place in reducing puppy mortality rates .
- Does healthy feeding promote reproduction in rabbit farming?
- Teat Dipping and Milk Iodine Concentrations in Dairy Cows .
- Healthy feeding as a tool for fighting allergies in cats.
- Reducing dietary mistakes to increase goat milk production.
- Good feeding and safe calving among dairy cows.
- Pet Food Product Marketing Strategy .
- Addressing the confusion surrounding protein’s role in pet food.
- Protein’s role in dairy cow health.
- The best foods for increased dairy production.
- Nature’s Best Pet Food Brand’s Target Market .
- Carbohydrates: why do dairy cows need them?
- How does green matter improve pigs’ health?
- Why might home-cooked food not be the right choice for pets?
- Nutrition for Gorillas at the National Zoo .
- Is good feeding enough to keep healthy laying hens?
- Healthy eating and pet diarrhea prevention.
- Best food storage practices for healthy pet rearing.
- The nutritive value of ruminant feeds .
- Preventing food poisoning among pets.
- What are the healthy feeding principles for kitten health?
- Is a carbohydrate-rich diet good for calves?
- Accurate pet food labeling and its impact on animal safety.
- The best diet to boost the health of cats with kidney disease.
Are you looking for unique topics to cover in your nutrition essay? Here are some good ideas in different nutrition science areas.
- Healthy diet as a tool for preventing and treating food allergies .
- Vitamin D deficiency in children in developing countries.
- Fitness and Nutritional Habits .
- Good feeding and obesity treatment in preschoolers.
- A healthy diet for mothers and pre-term infants.
- How Do Fried Foods Affect Nutrition for Young Adults?
- How does a poor diet fuel chronic sleep problems among teenagers?
- Does poor childhood nutrition increase cardiovascular risk in adulthood?
- Explore how different cultures handle food.
- Nutritional Necessities of Individuals with Disabilities .
- Explain the health benefits of cereal.
- What are healthy alternatives to white sugar ?
- Why is healthier brown bread less popular?
- Nutrition Goals, Types and Steps .
- Nutrients in white and brown bread : a comparison.
- Why isn’t meat still such a staple food in many African cultures?
- What are coffee’s healthier alternatives?
- Dietary Knowledge and Adult Overweight in China .
- Gut microbiome modifiers: are they a healthy option?
- The effects of vitamin D deficiency on older adults.
- Safer and healthier chocolate substitutes.
- Women Losing Their Periods Because of Diets and Exercise .
- Strategies to boost healthy eating among college students.
- Do eating disorders affect people’s mental performance?
- Therapeutic Diets Used in the Hospital .
- What is hunger’s role in anorexia?
- Benefits of healthy eating habits for adults.
Popular Nutrition Topics
Do you want to write a paper on trending topics that promote nutrition education ? Here are inspiring subject prompts.
- Eating In vs. Eating Out: Pros and Cons .
- Acne: how does a balanced diet prevent it?
- Recovery from alcoholism : how can a dietary regimen speed it up?
- How does good eating prevent Alzheimer’s disease?
- Eating Habits in UK: From Past Till Now .
- How can a fruit-based diet promote antioxidation?
- Does a healthy diet prevent arthritis?
- Eating Healthy and Its Link to Obesity .
- Beans and their role in preventing anemia.
- Cancer: does good dieting prevent it?
- How good feeding prevents high blood pressure.
- Eating Habits among the Teenagers .
- Cholesterol levels: how much is safe?
- Coffee: what is its dietary value to the body?
- Eating Fast Food and Obesity Correlation Analysis .
- A dairy-based diet and its effect on overall body health.
- Depression: can healthy eating reduce it ?
- How do eggs promote healthy living?
- Malnourishment: Eating Habits .
- Fasting as a tool to boost healthy living.
- What is the best diet for men’s health?
- Indian Cuisine: Food and Socio-Cultural Aspects of Eating .
- The best foods for improving women’s health.
- Omega-3 fatty acids: the silver bullet against cardiovascular diseases?
- Pregnancy : the most significant adjustments to boost mother and baby health.
- Eating Habits, Brain’s Role and Advertising Impact Analysis .
- Turmeric: its hidden health benefits in boosting the body’s anti-inflammation power.
- The best foods to eat for improved dental health.
Controversial Nutrition Topics
Are you searching for controversial nutrition topics to research? Here’s our list of the best ideas for college students.
- Are vegan athletes better performers than meat-eating ones?
- Eggs and Salmonella as Ethical Dilemma in Community .
- Carbon footprint labeling : why it should be mandated.
- Are foods safer than supplements?
- High-Risk Nutritional Practices in the US and China .
- Why are artificial sweeteners not good for health?
- Infant formulas promote laziness among mothers.
- Nutrition: Obesity Pandemic and Genetic Code .
- The role of micronutrients in promoting a healthy pregnancy.
- How does nutrition support promote Lyme disease treatment ?
- Personalized diet plans and why they fail most of the time.
- Nutritional Challenges for Government .
- Collagen supplements: do they work?
- All hydroponics crops can’t qualify as organic.
- Genetically Modified Food Safety and Benefits .
- Do dietary supplements assist in treating type 2 diabetes?
- There’s no such thing as “healthy” fast food.
- All fast foods are slow poisons.
- Causes and Effects of Fast Food: Essay Example .
- Are soy foods a silver bullet in promoting good thyroid health?
- Why do pesticides affect the overall safety of farm produce?
- All industrial meats are sweet poison.
- Vegetarian Diet and Animal Testing Theory .
- Does the Keto diet help treat cancer, or is it a myth?
- Red meat is safer than what most people believe.
- Fad Diets and Their Impact on Human Health .
- Natural red meat is safer than GMO crops.
- Energy drinks : why you should question their efficacy.
Other Nutrition Topics to Write About
Do you want some more ideas for your research paper ? Here are additional interesting nutrition topics to consider.
- Eating a vegetarian diet : a fad or a necessity?
- Nutritional value of wild Amaranth grain .
- Healthy eating: why it is the safest medicine.
- Sufficient hydration and healthy living.
- Nutritional health as an important aspect of geriatric care .
- Diet and health: prevention of lifestyle diseases .
- How can good feeding fix most digestive disorders?
- The Supplemental Nutrition Assistance Program in the US economy .
- Eating disorders among teens and how a good diet at home can prevent them.
- Food allergies and intolerance among teens.
- Healthcare nutrition: dieting for reducing weight and improving optimal health .
- Good diet and heart health among children.
- High blood pressure and how healthy eating can prevent it.
- Dairy products consumption and obesity .
- A balanced diet for effective osteoporosis management .
- Dietary supplements and healthy diet.
- Nutrition issues: obesity and breastfeeding .
- Herbal supplements and gut health.
- Vitamin supplements for elderly people.
- Hunger and environmental nutrition .
- Mineral supplements for pregnant mothers.
- Food poisoning and its complications.
- Nutrition’s impact in developing type II diabetes mellitus .
- Safe food preparation promotes good health.
- Diets for weight management among teenagers.
- Congestive heart failure and nutrition issues .
- The best nutrition for adolescents.
- The best diet for senior citizens.
- Cystic fibrosis and malnutrition in children .
- Correct meal planning and good health.
Creating a presentation about nutrition can be an exciting task. You can not only describe but also illustrate different cuisines, diet plans , food preparation processes, and more. Do you need trending nutrition research topics for your presentation? Here are our carefully selected title examples for your inspiration.
- Healthy diets for a busy lifestyle.
- Nutrition in China: red yeast rice .
- The best foods for mood improvement.
- How good eating protects against aging-related inflammation.
- Nutrition: how to prepare scrambled eggs ?
- Understanding the best foods for children.
- Is intermittent fasting another form of disordered eating?
- Track your diet: diet observation and nutritional choices .
- Intermittent fasting: how does it restrict calories?
- Calorie-control diets: how effective are they?
- Healthy nutrition: obesity prevention in young children .
- Are calorie-control diets safe?
- Does the cookie diet protect users against obesity?
- Diet and nutrition trends .
- Does juice fasting really work?
- The effects of a master cleanse diet in promoting natural detoxification .
- Malnutrition in patients: causes and stakeholders .
- Does pricing GMO foods lower make them worth the try?
- Are costlier, safer organic foods worth the extra penny?
- Culinary arts and nutrition .
- Why do many first-year college students gain weight?
- How do nutritional choices affect a mother’s breast milk quality?
- Nutrition for active life: innovative nursing care .
- How do diet choices affect performance in the workplace?
- Explain how a school’s food choices affect student health.
- Nutrition labeling: meaning and importance .
- Why do people become addicted to junk food ?
- How do professional athletes influence people’s dietary choices?
- Nutrition: anatomy of a supermarket purchase .
- Describe how a vegan diet impacts one’s overall health.
- Does one’s eating schedule affect their general health?
- High-risk nutritional behaviors .
- Does GMO food acceptance thrive on mass ignorance?
- How does malnutrition affect children’s bodily health?
- Nutrition before and after gastric bypass .
- Explain how malnutrition affects a child’s mental health .
- How do healthy food decisions affect brain development ?
- Nutritional practices for infants and toddlers .
- Does people’s financial power directly determine their dietary choices?
- How do a pregnant mother’s dietary choices affect her unborn baby’s immunity?
- Nutritional “cures” for clients with cancer or HIV-AIDS .
- Explain how income levels and nutrition awareness affect eating choices.
- Explain how late-night eating affects one’s health.
- Benton County nutrition action plan .
- What lessons can people learn from the Kosher diet ?
Check out more nutrition topics for college students to supercharge your nutrition paper.
- How do the cuisines of different countries differ when determining a balanced diet?
- Effects of nutrition on cancer and cardiovascular disease control .
- How does infants’ nutrition affect their future lives?
- What challenges are linked to dietary policy implementation in Africa?
- Malnutrition in hospitalized patients .
- Discuss the possible health risks of pasteurized milk.
- What are the nutritional effects of homemade food?
- Nutrition supplement knowledge among low-income students .
- How does a good diet promote healthy brain formation?
- Nutritional challenges facing women in refugee camps.
- Nutrition for a cerebral palsy patient .
- Do parents’ eating patterns affect children’s nutritional choices?
- Strategies to protect college young adults from eating disorders.
- Role of nutrition in supporting fitness and exercise .
- Analyze America’s school lunch programs .
- Improving children’s food choices to prevent chronic disorders.
- The importance of nutritional labeling on packaged food .
- Is overhydration as harmful as dehydration ?
- Analyze how excess vitamins can negatively affect good health.
- The health impacts of non-nutritive sweeteners .
- How do carbohydrates transform into energy?
- Sugar varieties and their nutritional impact.
- Japan’s food patterns and nutrition habits .
- FDA recommendations for a healthy nutritional intake.
- Non-digestible substances: examine their role in improving health.
- Healthy eating plate: nutritional recommendations .
- How does a healthy diet promote strong connective tissue development?
- What eating disorders promote poor antioxidant intake?
- Artificially administered nutrition and hydration .
- How does a controlled healthy diet help manage diabetes?
- Discuss the long-term implications of dehydration in children.
- Nutritional changes in risotto recipes .
- Explain the long-term ramifications of fasting.
- How does a poor diet expose people to cancer?
- The social justice and nutrition in a family .
- How do depression and anxiety affect malnourished children?
- How does a good diet affect anxiety in patients?
- Influence of media on nutritional choices in school-age children .
- Compare and contrast how fats affect different animals.
- Does embracing a vegan diet for a long time have negative health implications?
- Nutrition: impact on human health and self-esteem .
- Why do expectant mothers crave various foods?
- Does taking processed sugar for a long time cause diabetes?
- Diet and nutrition for hepatitis treatment .
- Junk food and its long-term effects.
This was the most exhaustive list of nutrition topics. However, if you still have not found what you’re looking for, check out our free research title generator . Please share the content with friends and leave us a thumbs-up comment if you liked this material and found it helpful.
- Research Topics | Department of Nutritional Sciences, University of Connecticut
- Food Nutrition Current Topics of Investigation | Illinois Institute of Technology
- Trending Topics | University of Toronto
- The 11 Biggest Health Controversies of All Time | The Healthy
- Popular Topics | NutritionFacts.org
- Nutrition as We Age: Healthy Eating with the Dietary Guidelines | Health.gov
- Animal Nutrition Research | Texas A&M University
- Trending Topics in Pet Nutrition | Tufts University
- Nutrition and Global Health | Harvard T. H. Chan
- Topics in Clinical Nutrition | ResearchGate
- Nutrition, Exercise, and Sports | Wageningen University & Research
- Nutrition Articles from across Nature Portfolio | Nature
- Nutrition Research | Food Standards Agency
- Dietetics, Human Nutrition, and Health Projects | University of Plymouth
- Topics | Food Systems, The University of Milan
- Food Industry Hot Topic Articles and Resources | BSI
- Research Topics | Università di Bologna
- Food System Research and Project Ideas for JHU Students AY2019 | Johns Hopkins University
- Food Trends 2023 | PennState Extension
Tips to Study Faster: a Guide for Struggling Learners
How to make a powerful student vision board, how to stop overthinking: 11 tips & 3 simple exercises, pomodoro technique for studying: benefits & tips, how to be a successful first-generation student: top 11 tips, the ultimate tax guide for students: tips, tricks, & helpful info.
293 Good Nutrition Research Topics & Ideas
- Icon Calendar 18 May 2024
- Icon Page 2323 words
- Icon Clock 11 min read
Nutrition research topics encompass a wide study spectrum of explorations in dietary science and human health. They often delve into various areas like nutritional epidemiology that analyzes possible correlations between diet patterns and disease incidence. Nutrigenomics studies how specific nutrients impact gene expression, while functional foods evaluate the health benefits of particular food components. Additional study areas include research into eating disorders and how socioeconomic factors influence diet. Child and prenatal nutrition form a critical aspect, examining how early dietary habits shape long-term health. Sustainability and public health nutrition also make key research areas, investigating global food supply issues and dietary policy development. Such studies may employ methods from biochemical analysis to large-scale population surveys. Therefore, nutrition research topics underscore nutrition’s vital role in supporting human health and well-being.
Best Nutrition Research Topics
- Balancing Macronutrients for Optimal Health
- Sugar’s Influence on Obesity Rates
- Vitamin D Deficiency: Consequences and Prevalence
- Benefits of Probiotics and Gut Health
- Ketogenic Diet and Cognitive Function
- Childhood Obesity and Nutritional Interventions
- Intermittent Fasting: Health Benefits and Drawbacks
- Influence of Dietary Fiber on Digestive Health
- Mediterranean Diet’s Correlation with Longevity
- Plant-Based Diets and Cardiovascular Health
- Link Between Nutrition and Mental Health
- Analyzing the Nutritional Content of Fast Food
- Antioxidant-Rich Foods and Their Benefits
- Dietary Strategies for Managing Diabetes
- Optimal Nutrition for Athletic Performance
- Food Deserts and Nutrition Inequality
- Effects of Caffeine on Human Health
- Exploring the Health Impact of Organic Foods
- Prebiotics in Dietary Interventions for Gut Health
- Nutritional Implications of Food Allergies and Intolerance
Easy Nutrition Research Paper Topics
- Understanding Food Labels: Nutrition Facts Explained
- Health Benefits of Drinking Enough Water
- Whole Foods vs. Processed Foods: A Comparative Analysis
- Exploring Different Types of Dietary Fats
- Roles of Fruits and Vegetables in a Balanced Diet
- Impacts of Excessive Salt Intake on Health
- Gluten-Free Diet: Health Fad or Essential for Some?
- Why Is Breakfast Considered an Important Meal?
- Assessing the Nutritional Value of Dairy Products
- Influence of Proper Hydration on Athletic Performance
- Examining the Popularity of Superfoods
- Detox Diets: Do They Really Work?
- Health Consequences of Consuming Fast Food
- Unpacking the Concept of Calorie Counting
- Investigating the Health Benefits of Tea vs. Coffee
- Importance of Balanced Nutrition for Children
- Defining and Understanding the Concept of ‘Organic’ Food
- Exploring the Dangers of Sugar Addiction
- Demystifying the Health Claims of Popular Diets
Interesting Nutrition Research Topics
- Algae as a Sustainable Source of Nutrients
- Deconstructing the Paleo Diet: Benefits and Drawbacks
- Nutritional Genomics: Personalizing Diets Based on DNA
- Integrating Edible Insects Into Western Diets
- Ayurvedic Diet Principles and Health Outcomes
- Assessing the Nutritional Claims of Energy Drinks
- Nootropics and Nutrition: Enhancing Cognitive Function Through Diet
- Linking Mindful Eating and Nutritional Health
- Food Combinations for Maximum Nutrient Absorption
- Influence of the Microbiome on Nutrient Metabolism
- Exploring Nutritional Differences in Various Cooking Methods
- Examining Nutrient Density: The Best Bang for Your Calorie Buck
- Investigating the Nutritional Pros and Cons of Food Fortification
- Fasting Mimicking Diets and Longevity
- Analyzing the Nutritional Value of Plant-Based Meat Alternatives
- Investigating the Nutrition of Space Food for Astronauts
- Nutritional Interventions in Managing Autoimmune Diseases
- Roles of Nutrition in Aging Well
- Fermented Foods and Gut Health: A Deep Dive
- Unraveling the Science Behind Chocolate and Health
Nutrition Research Paper Topics for High School
- Healthy Eating Habits for Teenagers
- Examining Nutritional Needs During Adolescence
- Junk Food Consumption and Health Consequences
- Importance of Calcium Intake for Teens
- Sports Nutrition for Young Athletes
- Analyzing the School Lunch Program’s Nutritional Content
- Effects of Sugar-Sweetened Beverages on Youth Health
- Understanding Eating Disorders: Anorexia and Bulimia
- Debate on Mandatory Nutrition Education in Schools
- Impacts of Vegetarianism on Teen Health
- Influence of Social Media on Teenage Nutrition Choices
- Investigating the Health Risks of Teen Dieting
- Iron Needs and Deficiency in Adolescents
- Body Image, Peer Pressure, and Nutrition
- Relationship Between Nutrition and Acne in Teenagers
- Nutrition Strategies for Managing Teen Stress
- Vitamin B Complex: Importance for Teens
- Why Is Protein Crucial for Teen Development?
- Exploring Teenage Obesity: Causes and Prevention
- Understanding Food Addiction in Teenagers
Nutrition Research Topics for College Students
- Managing Healthy Eating in College
- Nutritional Challenges of Vegetarian and Vegan Students
- Effects of Alcohol on Nutrition and Health
- Importance of Omega-3 Fatty Acids in Brain Function
- Deciphering Food Marketing and Labeling
- College Athletes and Nutritional Needs
- Understanding and Avoiding the ‘Freshman 15’
- Nutrition Strategies for Sleep-Deprived Students
- Nutritional Contributions to Mental Health in College
- Benefits of Home Cooking vs. Eating Out
- Correlation Between Nutrition and Academic Performance
- Effects of Coffee Consumption on College Students
- Examining Eating Disorders in College Populations
- Nutritional Implications of Late-Night Snacking
- Vitamins and Supplements: Necessity or Luxury?
- Influence of Diet on Mood and Stress
- Understanding the Ketogenic Diet
- Impact of Fast Food Culture on College Life
- Decoding the Nutritional Value of Smoothies
Research Topics for Nutrition of Students
- Student Diets and Their Effect on Concentration
- Assessing the Nutritional Status of University Students
- Connections Between Nutrition and Students’ Mental Health
- Study Habits and Their Influence on Students’ Eating Patterns
- Evaluating School Canteens for Nutritional Quality
- Impacts of Excessive Caffeine Intake on Students
- Prevalence of Eating Disorders Amongst University Students
- Nutritional Deficiencies in College Student Populations
- How Stress Affects Eating Habits of Students
- Factors Affecting Healthy Eating Choices in Students
- Link Between Students’ Diets and Their Physical Activity
- Effects of Alcohol Consumption on Students’ Nutritional Intake
- Influence of Food Advertising on Students’ Diet Choices
- Benefits and Drawbacks of Dietary Supplements for Students
- Food Insecurity Among University Students
- Assessing the Impact of Campus Dining on Student Health
- Exploring Vegan and Vegetarian Trends Among Students
- Investigating Links Between Breakfast Habits and Academic Performance
- Relationship Between Social Life and Eating Habits in University Students
- Preventing Malnutrition in Low-Income Student Populations
Research Topics About Essential Nutrients
- Exploration of Vitamin D Deficiency in Northern Climates
- Analysis of Iron Deficiency Anemia in the Modern Age
- Effect of High Fiber Diets on Digestive Disorders
- Correlation Between B-Vitamin Intake and Cognitive Function
- Decoding the Nutritional Benefits of Omega-3 Fatty Acids
- Significance of Vitamin K in Bone Health and Coagulation
- Investigating Zinc’s Contribution to Immune System Function
- Understanding the Metabolism of Water-Soluble Vitamins
- Elucidating the Bioavailability of Different Forms of Calcium
- How Magnesium Regulates Neuromuscular Transmission and Other Biochemical Reactions
- Investigating the Correlation Between Selenium and Thyroid Function
- Assessing the Contribution of Essential Fatty Acids to Mental Health
- Exploring Copper Deficiency and Its Effects on Health
- Examining Vitamin A and Its Contribution to Vision Health
- Deciphering the Biochemistry of Essential Amino Acids
- Bioavailability and Metabolic Pathways of Vitamin E
- Study of Iodine and Its Importance in Thyroid Health
- Nutritional Genomics: Tailoring Diets to Individual Nutrient Needs
- Investigation Into Potassium’s Role in Cardiovascular Health
Food Choices and Nutrition Research Topics
- Influence of Fast Food Advertising on Dietary Habits
- Navigating Veganism: Nutritional Challenges and Solutions
- Dietary Intake and Its Link to Chronic Diseases
- Comparing Nutrient Content: Home-Cooked Meals vs. Takeout
- Assessing Food Labels for Nutritional Accuracy
- Rise of Plant-Based Diets: Health and Environmental Impacts
- Balanced Diet for Athletes: Performance and Recovery
- Eating Disorders: Nutritional Aspects and Intervention Strategies
- Optimizing Diets for Aging Populations: Nutritional Needs and Limitations
- Malnutrition in Developing Countries: Causes and Solutions
- Organic Food Consumption: Health Benefits and Misconceptions
- How Social Factors Shape Our Food Choices
- Effects of Sugar Consumption on Metabolic Health
- Mediterranean Diet: Health Benefits and Implementation
- Cultural Diversity in Dietary Practices: An Overview
- Eating Habits in College: The Freshman Fifteen Phenomenon
- Food Deserts’ Impact on Community Health
- Understanding the Nutritional Implications of Food Allergies
- Gluten-Free Diets: Health Implications and Misconceptions
Food Groups in Nutrition Research Paper Topics
- Whole Grains and Digestive Health: A Comprehensive Study
- Dairy Products and Bone Health: Decoding the Connection
- Analyzing Nutritional Components of Various Fruits
- Exploring the Health Benefits of Different Vegetables
- Redefining the Food Pyramid: An In-Depth Analysis
- Meat Consumption and Its Implications for Human Health
- Poultry and Fish: Comparative Nutritional Values
- Legumes and Pulses: Unexplored Nutritional Goldmines
- Roles of Nuts and Seeds in Reducing Chronic Diseases
- Influence of Processed Foods on Modern Dietary Patterns
- Understanding the Nutritional Powerhouse: Leafy Greens
- Eggs: Nutrient-Dense Food or Cholesterol Culprit?
- Debunking Myths Surrounding Soy Products
- Seafood Nutrition: Omega-3 Fatty Acids and Beyond
- Mushrooms: A Forgotten Food Group With Nutritional Richness
- Food Synergy in Combining Different Food Groups
- Whole Foods vs. Refined Foods: Nutritional Differences
- Roles of Fermented Foods in Gut Health
- Deciphering the Nutritional Content of Root Vegetables
- Unsaturated Fats: Health Benefits of Avocados and Olives
Healthy Nutrition Research Topics
- Dietary Fibers and Cardiovascular Health: A Detailed Exploration
- Probiotics for Gut Health: Understanding the Mechanisms
- Antioxidants in Berries: The Shield Against Oxidative Stress
- Nutritional Approaches for Managing Diabetes: A Comprehensive Study
- The Interplay of Sodium and Potassium in Blood Pressure Regulation
- Omega-3 Fatty Acids: The Key to Heart Health
- Minerals in Human Health: Exploring the Underrated Components
- Examining the Health Benefits of Polyphenols
- Vitamin D and Bone Health: Going Beyond Calcium
- Holistic Health Benefits of a Plant-Based Diet
- Relevance of Hydration in Physical Health and Performance
- Nutrition’s Influence on Mental Health: Decoding the Gut-Brain Axis
- Unraveling the Connections: Obesity and Nutritional Imbalances
- Iodine, Thyroid Health, and Metabolism: A Detailed Investigation
- Importance of Amino Acids in Muscle Health and Recovery
- Iron Deficiency: Anemia and Beyond
- Magnesium: An Essential Nutrient for Nervous System Functioning
- Power of Zinc in Immune Health and Disease Resistance
- The Link Between Nutrition and Skin Health: An In-Depth Analysis
Nutrition Research Topics on Dietetics
- Dietary Approaches to Stop Hypertension: A Dietitian’s Perspective
- Understanding the Science Behind Ketogenic Diets
- Vegetarian and Vegan Diets: Nutrient Adequacy and Health Implications
- Clinical Nutrition in Managing Chronic Kidney Disease
- Intervention Strategies in Pediatric Obesity: A Dietetic Approach
- Effectiveness of Mediterranean Diet in Chronic Disease Prevention
- Influence of Low-FODMAP Diet on Irritable Bowel Syndrome
- Nutrition Therapy in Cancer Management: Dietetics in Action
- Low Carbohydrate Diets and Type 2 Diabetes Management
- Examining Nutritional Issues in Geriatric Populations
- Dietary Management in Celiac Disease: Beyond Gluten-Free
- Micronutrient Requirements in Pregnancy: A Dietetic Approach
- Nutritional Interventions in Post-Bariatric Surgery Patients
- Pediatric Nutrition: Addressing Failure to Thrive
- Decoding the Nutritional Management of Eating Disorders
- Balancing Nutrition and Palatability in Dysphagia Management
- Managing Food Allergies: A Dietetics Perspective
- Enteral and Parenteral Nutrition: Practical Issues and Challenges
- Influence of Plant-Based Diets on Cardiovascular Health
- Nutrition Support in Critically Ill Patients: The Role of Dietetics
Research Topics About Nutrition for the Treatment of Eating Disorders
- Recovery Nutrition Strategies for Anorexia Nervosa
- Implementing Mindful Eating in Bulimia Nervosa Treatment
- Food Phobia and Its Nutritional Consequences in Eating Disorders
- Orthorexia Nervosa: Where Health Consciousness Crosses the Line
- Nutrient-Dense Diets in the Management of Eating Disorders
- Balanced Diet Plans for Binge Eating Disorder Patients
- Ketogenic Diets: A Possible Intervention for Eating Disorders?
- Addressing the Nutritional Deficiencies in Anorexia Athletica
- Understanding Refeeding Syndrome in Severe Anorexia Nervosa Cases
- Carbohydrate-Centric Approach to Treat Bulimia Nervosa
- Exploring the Nutritional Implications of Avoidant Restrictive Food Intake Disorder
- Macro and Micronutrients Management in Anorexia Nervosa Treatment
- Assessing the Role of Dietary Fats in Bulimia Nervosa Recovery
- Managing the Nutritional Challenges in Night Eating Syndrome
- Food Variety and Its Importance in Eating Disorders Treatment
- Bariatric Surgery for Severe Binge Eating Disorder: Nutritional Challenges
- Influence of Veganism on the Progression of Eating Disorders
- Postprandial Timing: Its Influence on Binge Eating Disorder
- Nutritional Rehabilitation in Hospitalized Eating Disorder Patients
Sports Nutrition Research Paper Topics
- Optimization of Protein Intake in Endurance Athletes
- Micronutrients’ Importance for Athletic Performance
- Carbohydrate Loading: A Tool for Marathon Runners
- Ketogenic Diet and Its Effect on Athletic Performance
- Hydration Strategies for Long-Distance Athletes
- Nutritional Strategies to Enhance Recovery in High-Intensity Sports
- Effects of Caffeine on Athletic Performance
- Iron Requirements in Female Athletes: Meeting the Demand
- Dietary Supplements and Performance in Elite Athletes
- Bone Health and Nutrition in Weightlifting Athletes
- Optimizing Pre-Game Nutrition for Competitive Athletes
- Nutritional Implications of Aging on Athletic Performance
- Creatine Supplementation in High-Intensity Training
- Influence of Plant-Based Diets on Athletic Performance
- Gut Health and Performance in Athletes: The Link
- Nutrition Strategies for Managing Injuries in Athletes
- Understanding Energy Availability in Endurance Sports
- Probiotics and Their Potential Benefit for Athletes
- Omega-3 Fatty Acids and Their Relevance to Athletic Performance
- Alcohol and Its Consequences on Sports Performance
Nutrition Research Topics About Veganism & Vegetarianism
- B12 Deficiency in Vegan and Vegetarian Diets
- Plant-Based Diets: Protein Quality and Quantity
- Bone Health Among Vegans and Vegetarians
- Exploring Iron Bioavailability in Plant-Based Diets
- Omega-3 Fatty Acids: Achieving Adequate Intake on a Vegan Diet
- Veganism, Vegetarianism, and Cardiovascular Health
- Effect of Plant-Based Diets on Blood Glucose Control
- Zinc Absorption in Vegan and Vegetarian Diets
- Evaluating Vegan and Vegetarian Diets for Athletes
- Nutrient Density in Vegan and Vegetarian Diets
- Challenges of Meeting Calcium Needs on a Vegan Diet
- Plant-Based Diets and Gut Microbiota
- Weight Management in Vegan and Vegetarian Lifestyles
- Influence of Vegan Diet on Inflammatory Markers
- Plant-Based Diets: Effect on Mental Health
- Comparison of Antioxidant Intake: Vegans vs. Omnivores
- Influence of Veganism on the Ageing Process
- Plant-Based Diets and All-Cause Mortality
- Perception of Hunger and Fullness in Vegans vs. Omnivores
Food Science Research Paper Topics
- Microbial Safety of Fermented Foods
- Structural Changes in Proteins During Cooking
- Antioxidant Properties of Spices and Herbs
- Functional Foods and Gut Health
- Bioavailability of Nutrients From Different Cooking Methods
- Flavor Chemistry and Perception in Food Development
- Effects of Processing on Phytonutrient Content
- Metabolic Pathways Involved in Fermentation
- Novel Techniques in Food Preservation
- Food Texture and Its Effect on Satiety
- Influence of Food Structure on Nutrient Absorption
- Bioactive Compounds in Functional Beverages
- Chemical Changes in Food During Storage
- Advancements in Food Packaging Technologies
- Understanding Maillard Reaction in Different Food Products
- Innovative Techniques in Food Fortification
- Sustainable Food Processing Techniques
- Potential Health Benefits of Probiotic Foods
- Food Allergens: Detection and Quantification Methods
- Sugar Substitutes: Health Benefits and Risks
To Learn More, Read Relevant Articles
333 Art Research Paper Topics & Ideas
- Icon Calendar 8 June 2023
- Icon Page 2457 words
351 Environmental Science Research Topics & Ideas
- Icon Calendar 7 June 2023
- Icon Page 2791 words
Home > Health Sciences > Nutrition > Theses and Dissertations
Nutrition Department Theses and Dissertations
Theses/dissertations from 2024 2024.
IMPROVING THE DIET QUALITY OF WIC-PARTICIPATING WOMEN USING DIGITAL FOOD ENVIRONMENTS , Yarisbel Melo Herrera
THE URI FREE FARMERS’ MARKET AND FOOD ACCESS AMONG COLLEGE STUDENTS , Maria Meola
IMPLEMENTATION AND EVALUATION OF A NUTRITON-FOCUSED STEAM SUMMER PROGRAM FOR URBAN YOUTH , Jacquelyn Potvin
EFNEP PEER EDUCATOR FACILITATORS AND BARRIERS TO TEACHING PHYSICAL ACTIVITY TO ADULT PARTICIPANTS , Luisa Santos
Theses/Dissertations from 2023 2023
ASSOCIATIONS BETWEEN OYSTER CONSUMPTION AND IRON, ZINC, AND CADMIUM CONCENTRATIONS IN GHANAIAN WOMEN , Alyssa Abreu
ASSOCIATIONS BETWEEN STRESS, INTUITIVE EATING, AND ADIPOSITY IN A COHORT OF MIDLIFE WOMEN , Bridget A. Owens
POSITIVE FEEDING PRACTICES, TOTAL FRUIT INTAKE, TOTAL VEGETABLE INTAKE, AND OVERALL DIET QUALITY IN CHILDREN OF ETHNICALLY AND RACIALLY DIVERSE FAMILIES , Jordan E. Young
Theses/Dissertations from 2022 2022
DIETARY MAGNESIUM INTAKE AND RISK OF TYPE 2 DIABETES MELLITUS IN GHANAIAN WOMEN OF REPRODUCTIVE AGE , Helena Bentil
MATERNAL EXPERIENCES OF DISCUSSING COMPLEMENTARY FEEDING IN PRIMARY CARE , Kelly Lynn Bouchard
FREQUENCY OF FOOD CRAVINGS IN ADULTS CONSUMING ANIMAL- OR PLANT-BASED DIETS , Kate Thomas
Theses/Dissertations from 2021 2021
ANTECEDENTS OF CHILDHOOD OBESITY RISK FACTORS, A SELF DETERMINATION THEORY PERSPECTIVE , Katelyn Fox
DIETARY FERMENTABLE CARBOHYDRATE (FC) CONSUMPTION AND ASSOCIATIONS WITH DIET QUALITY AND HEALTH PARAMETERS , Ajita Jadhav
FORMATIVE EVALUATION OF A STEAM AND NUTRITION EDUCATION SUMMER PROGRAM FOR LOW-INCOME YOUTH , Jacquelyn Potvin
Theses/Dissertations from 2020 2020
PRENATAL VITAMIN USE IN RHODE ISLAND ACCORDING TO WOMEN, INFANTS, AND CHILDREN (WIC) PARTICIPATION , Allisa Georgio
TAILORING DIGITAL HEALTH TO IMPROVE THE NUTRITION AND HEALTH OF PEOPLE WITH PARKINSON’S DISEASE , Dara Lyn LoBuono
ASSOCIATIONS OF WEIGHT DISSATISFACTION ON DIET QUALITY, PERCENT BODY FAT, AND PHYSICAL ACTIVITY IN COLLEGE STUDENTS , Kelsey McNulty
DIETARY AND SUPPLEMENTAL MAGNESIUM INTAKE DURING PREGNANCY AND ITS ASSOCIATION WITH GESTATIONAL DIABETES , Celia Palmer
DIETARY CONTRIBUTORS TO FOOD GROUP INTAKE IN PRESCHOOL CHILDREN ATTENDING FAMILY CHILDCARE HOMES , Andrea Ramirez-Sanabria
CONSTRUCTION AND VALIDATION OF A VIDEO CODING TOOL FOR AN INTERVENTION TO IMPROVE PARENTAL FEEDING , Margaret Doyle Samson
Theses/Dissertations from 2019 2019
MATERNAL BLOOD PRESSURE IN RELATION TO LOW BIRTH WEIGHT AND THE EFFECT OF A NUTRITIONAL SUPPLEMENT , Alyssa Abreu
ROLE OF CRITICAL NUTRITION LITERACY IN MAKING INFORMED DECISIONS ABOUT DIETARY BEHAVIOR , Janette Nazeli Bedoyan
PILOT TESTING A NUTRITION AND MOTIVATIONAL INTERVIEWING CURRICULUM FOR NURSING STUDENTS , Taylor Benson Berlinsky
SMALL FOOD STORES ASSESSMENT IN LOW INCOME LOW ACCESS COMMUNITIES IN PROVIDENCE, RHODE ISLAND , Yuyao Huang
EFFECT OF EATING PACE INSTRUCTIONAL CLASSES AT THE MICROSTRUCTURAL LEVEL OF BITES , Carolyn N. Matsumoto
THE HOME AND CHILD-CARE: ARE PRESCHOOLAGED CHILDREN GETTING MIXED FOOD-RELATED MESSAGES? , Noereem Zenaida Mena
EVALUATION OF A POLICY, SYSTEM, AND ENVIRONMENTAL SCHOOL-BASED FRUIT AND VEGETABLE INTERVENTION , Caterina Marie Morgera
Theses/Dissertations from 2018 2018
EFFECT OF A TECHNOLOGY-INTEGRATED, NUTRITION EDUCATION PROGRAM ON LOW-INCOME YOUTHS’ DIETARY INTAKE , Kate Balestracci
Exploring the Role of a Novel Device in Weight Loss Outcomes and Behaviors , Jacqueline Ann Beatty
CITY OF PROVIDENCE COMMUNITY READINESS FOR AN OBESITY PREVENTION INTERVENTION , Jessie Boukarim
Are Feeding Practices of Family Child Care Home Providers Related to Child Fruit & Vegetable Intake? , Tayla M. Carter
Impact of a Policy, Systems, and Environmental Intervention of Low-Income 5 th Grade Students' Self-Efficacy , Sabrina G. Hafner
Knowledge, Attitudes and Behaviors to Dietary Management of Parkinson’s Disease , Leah Marie Hurley
Examining Diet Quality and Sleep Duration in Overweight/Obese Adults in a Weight Loss Intervention , Megan Naquin
Maternal Sociodemographic Characteristics and Prenatal Diet Quality , Haley Wynne Parker
Evaluation of a School-Based Fruit and Vegetable Intervention Using a Digital Photography Method , Natalie Ruth Weisfeld
INCREASING CRITICAL THINKING IN PERSONAL DECISION MAKING- A CONTEXTUAL FRAMEWORK FOR COLLEGE STUDENTS , Jade A. White
Theses/Dissertations from 2017 2017
A Carbohydrate Counting Intervention for Hispanics with Type 2 Diabetes , Flavia Cattaneo
Effect of a Nutritiion Intervention on Fruit and Vegetable Intake in Elementary School Students , Jennifer L. Goodwin
Process of Evaluation of an EFNEP-Enhanced PSE Intervention in Urban Schools , Silvia X. Lepe
Content Validation of a Home Parenteral Nutrition Patient Reported Outcomes Questionnaire , Tracy-Lee Miller
Associations Between Nighttime Eating and Total Caloric Intake in College-Aged Students , Marissa Christina Ruginski
Diet Quality of Preschool Aged Children in Family Child Care Homes , Maggie You Ming Tsai
Associations Between Weight Dissatisfaction, Fruit and Vegetable Intake, Physical Activity and Personality Traits , Katherine Tzepos
Theses/Dissertations from 2016 2016
Evaluation of a Technology Utilizing Nutrition Curriculum on Dietary Intake , Kelsi Chappell
Acceptability, Short Term Impacts, and Relationships of Variables of a Processed Food Module , Jacqueline Corbett
Exploring Self-Reported and Observed Feeding Practices of Rhode Island Head Start Teachers , Megan N. Fallon
Impact of Nutrition Education on Fruit and Vegetable Consumption in an Urban School District , Pauline R. Fallon
The Effect of Caffeine Supplementation on Muscular Endurance in Recreationally Active College Age Males , Mark Gauvin
Alkylresorcinols as Biomarkers of Whole-Grain Intake , Michael Robert MacArthur
Evaluating a Novel Device for Calorie Reduction: The Bite Counter Study , Gregory G. Mayette
Feasibility and Acceptability of a Home-Based Intervention to Modify Maternal Food Parenting Practices , Amy Michelle Moore
Predicting Body Fat and Blood Lipids with Sugars Intake , Eric Nelson
The Impact of the Healthy Children, Healthy Families Curriculum on Maternal Food Parenting Practices , Laura E. Otterbach
Nutritional Status, Cognition and Cardiometabolic Risk in Individuals with Neurological Disorders , Chelsea Paulin
Theses/Dissertations from 2015 2015
FOOD SAFETY AND SCHOOL GARDEN PROGRAM , Valerie Calberry
Examining Eating Rate in Women Recruited From Low-Income Sites , Anne Therese Edwards
TARGETING OBESOGENIC BEHAVIORS: PILOT TESTING A MODIFIED RHODE ISLAND EFNEP CURRICULUM , Sarah La Roque Harper
Fermentable Carbohydrate Intake and Differences in Health Parameters in US College Students , Brittany Navrkal
THE EFFECT OF A FAMILY-BASED DIETARY INTERVENTION ON DIETARY FIBER DENSITY IN CHILDREN AGES 6-11 , Jennifer Nobles
ATTENDANCE AT TYPE 1 DIABETES CAMP IMPROVES NUTRITION KNOWLEDGE IN CHILDREN AND ADOLESCENTS , Kaitlyn Whipple
Theses/Dissertations from 2014 2014
A Population-Based Nutrition Intervention in College Students , Jennifer Arts
THE IMPACT OF HIGH AND LOW FODMAP CONDITIONS ON BLOOD GLUCOSE CONCENTRATIONS IN HEALTHY YOUNG ADULTS , Evan William Kerr
INFLUENCE OF A WITHIN MEAL EATING RATE INTERVENTION ON OVERALL DIET QUALITY IN OVERWEIGHT AND OBESE WOMEN , Sean C. Krueger
THE NUTRITION AND PHYSICAL ASSESSMENT OF PATIENTS WITH NEUROLOGICAL DISORDERS , Dara Lyn LoBuono
CONTEXTUAL AND CULTURAL INFLUENCES ON PARENTAL FEEDING PRACTICES AND INVOVLEMENT IN CHILD-CARE CENTERS AMONG HISPANICS , Noereem Zenaida Mena
THE GREEN EATING PROJECT: WEB-BASED INTERVENTION TO PROMOTE ENVIRONMENTALLY CONSCIOUS EATING BEHAVIORS , Jessica T. Nash
EFFECT OF HIGH- AND LOW-FODMAP DIET INSTRUCTION ON FODMAP INTAKE AND DIETARY QUALITY IN HEALTHY YOUNG ADULTS , James O'Toole
THE EFFECT OF AN IPAD APPLICATION ON THE QUALITY OF LUNCHES BROUGHT FROM HOME BY MIDDLE SCHOOL CHILDREN , Christina Pryor
COLLEGE STUDENTS PERCEPTIONS OF ENVIRONMENTALLY CONSCIOUS EATING BEHAVIORS: A FORMATIVE EVALUATION , Victorine Shores
EVALUATION OF A SNAP-ED FAMILY MEAL BASED NUTRITION EDUCATION CURRICULUM , Aaron Slader
IMPACT ON NUTRITION RISK IN COMMUNITY DWELLING OBESE WOMEN WITH NUTRITION AND PHYSICAL ACTIVITY INTERVENTION , Amy Taetzsch
PARENTAL PERCEPTIONS OF THE RHODE ISLAND EXPANDED FOOD AND NUTRITION EDUCATION PROGRAM , Patrick Cooper Van Asch
ASSESSMENT OF FOOD SAFETY HANDLING PRACTICES AT FARMERS’ MARKETS IN RHODE ISLAND , Elizabeth Gran Vandeputte
Theses/Dissertations from 2013 2013
Green Eating and Dietary Quality in University Students , Garrick Brown
A Qualitative Study of the Perceived Value of Membership in the Oley Foundation by Home Parenteral and Enteral Nutrition Consumers , Katelyn Patricia Chopy
NICU Sodium Administration to Extremely Low Birth Weight Infants: Relationships with Recommendations and Growth , Donna Kelly
Stress, Lifestyle, and Diet in College Students: Analysis of the YEAH Study , Steven McPartland
Evaluating the Efficacy of a Nutrition Education Mini Lesson Series , Elizabeth B. Patnode
Theses/Dissertations from 2012 2012
The Effects of Whey and Soy Protein Supplementation on Appetite and Dietary Quality in Overweight and Obese College-Aged Individuals , Kerri Alexander
INCREASING BREASTFEEDING IN WIC PARTICIPANTS USING INFORMATION ABOUT FORMULA COST AS A MOTIVATOR , Viviane Fornasaro-Donahue
IMPACT OF THE HEALTH IT UP INTERVENTION ON PLASMA LIPIDS AND GLUCOSE IN COLLEGE STUDENTS , Shira Hirshberg
THE EFFECT OF GOAL SETTING ON FRUIT AND VEGETABLE CONSUMPTION AND PHYSICAL ACTIVITY LEVEL IN A WEB-BASED INTERVENTION , Stephanie O'Donnell
EATING PACE INTERVENTION CLASSES 3: FEMALE STUDENTS AT THE UNIVERSITY OF RHODE ISLAND FEINSTEIN CAMPUS , Ruthann Sampson
Theses/Dissertations from 2011 2011
EATING RATE, FASTING GHRELIN CONCENTRATIONS AND WEIGHT STATUS IN FEMALE COLLEGE STUDENTS AT THE UNIVERSITY OF RHODE ISLAND , Stephanie E. Perruzza
Theses/Dissertations from 2009 2009
An Examination of the Relationships Among Cardiorespiratory Fitness Status, Body Mass Index, Appetite and Grelin , Jennifer Arts
Theses/Dissertations from 2005 2005
Weight Loss and Health Outcome Differences Between African Americans and Caucasions Following Gastric Bypass Surgery , Wendy A. Anderson
Theses/Dissertations from 1994 1994
Physico-Chemical Characterization of Shark-Fins , Adel M. Al-Qasmi
Theses/Dissertations from 1989 1989
The Formulation of Premium-Style Ice Milk, Low in Lactose, Sugar and Fat , Thanos Alagialis
Analysis of Thiamin by Reverse Phase C18 Open Column Chromatography , Abdullah M. Alyabis
Theses/Dissertations from 1988 1988
Process and Quality Characteristics of Ocean Pout Surimi , Paul Akeng'o
Theses/Dissertations from 1987 1987
Polyphenol Oxidase Inhibition by Glucose Oxidase in Pink Shrimp ( Pandalus borialis ) , Mohammed H. S. Al-Jassir
Theses/Dissertations from 1986 1986
Determination of Retinol by Aqueous Reverse Phase Open Column System , Abdulaly B. Al-Abdulaly
A Method for the Immobilization of Xanthine Oxidase in CA-Alginate Membranes to Measure Hypoxanthine Concentration in Order to Assess Flesh Food Quality , Hamad A. Al-Awfy
Theses/Dissertations from 1985 1985
Effect of Temperature and Packaging Material on Vitamin A and Riboflavin in Milk , Abdulaziz Ahmed Al-Zawawi
Theses/Dissertations from 1984 1984
Quantitative Determination of Sugars in Gums , Mohammed Al-Hazmi
Theses/Dissertations from 1983 1983
The Effect of a Hypocaloric Diet on the Body Weight, Body Composition and Serum HDL Levels of Male Endurance Athletes , Ellen Carol Alina
Theses/Dissertations from 1982 1982
Androgen Biosynthesis in the Testis , Mary A. Acciardi
Nutrient Level in Saudi Arabia Wheat Flour , Abdulrhaman Al-Khalifah
Theses/Dissertations from 1981 1981
Determination of Animal Fat in Margarine by High Pressure Liquid Chromatography of the Sterols , Ali Alaidaros
Identification and Differentiation of Species in Cooked Meat by Vertical Plate Gel Electrophoresis , Hamad Al-Awfy
Advanced Search
- Notify me via email or RSS
- Collections
- Disciplines
Author Corner
OA icon designed by Jafri Ali and dedicated to the public domain, CC0 1.0.
All other icons designed by Adrien Coquet and licensed under CC BY 4.0.
Home | About | FAQ | My Account | Accessibility Statement
Privacy Copyright
UKnowledge > Martin-Gatton College of Agriculture, Food and Environment > Dietetics and Human Nutrition > Theses & Dissertations
Theses and Dissertations--Nutrition and Food Systems
Theses/dissertations from 2024 2024.
Increased Social Support and Maintained Weight Loss Among Post Metabolic and Bariatric Surgery Patients Following a Support and Nutrition-Based Program , Sydney Mae McIntosh
Theses/Dissertations from 2023 2023
MILK THISTLE SUPPLEMENTATION AND EXERCISE TO INFLUENCE BILIRUBIN AND BODY WEIGHT OUTCOMES , Don Arthur Matutina
IDEAL BODY WEIGHT AND BODY FAT PERCENTAGE PREDICT RELATIVE ENERGY DEFICIENCY IN SPORT (RED-S) SCORES IN COLLEGIATE ATHLETES , Emily Norman
EXAMINING THE UTILITY OF A KENTUCKY FCS COOPERATIVE EXTENSION CURRICULUM ON COMMUNITY MEMBERS’ HEALTHY AND SUSTAINABLE DIET-RELATED BEHAVIORS , Catharine Pickford
SEX DIFFERENCES IN CARDIOMETABOLIC RISK FACTORS IN YOUTH WITH OBESITY , Lucrecia Valdez
DEVELOPMENT OF A COMMUNITY-BASED PLAN FOR AN EFFECTIVE BEHAVIORAL INTERVENTION TO REDUCE CHILDHOOD OBESITY IN A RURAL APPALACHIAN COMMUNITY , Jennifer Stacy Wells
Theses/Dissertations from 2022 2022
Maximal Strength Training Increases Metabolic Energy Expenditure in Sedentary Adults Classified as Obese , Robert E. Anderson III
FAMILY AND CONSUMER SCIENCES EXTENSION AGENTS PERCEPTION OF A SUSTAINABLE EATING CURRICULUM FOR KENTUCKIANS , Lindley Barker
“It’s just part of our hospitality:” Examination of cultural factors that may inform future initiatives to improve health outcomes in a rural Appalachian community , Lauren Cassidy Batey
Farmers’ Market Incentive Program as an Intervention for Improving Behavior Regarding Fruit and Vegetable Consumption in Children and Adolescents , Madison Blades
PILOT STUDY: THE ROLE OF ONLINE GROCERY SHOPPING IN MEAL PLANNING & PREPARTION: UTILIZING TEXT MESSAGE BASED BEHAVIORAL NUDGES , Brittany Nikole Cox
Nutritional Status in Critical Care of COVID-19 Patients , Dolph Lewis Davis III
THE EFFECT ON INCORPORATING FRESH FRUITS AND VEGETABLES INTO AN EMERGENCY FOOD BOX PROGRAM IN RURAL APPALACHIA KENTUCKY , Zixuan Li
ATTENTIONAL BIAS, INHIBITORY CONTROL, AND FOOD REINFORCEMENT AS MECHANISMS PROMOTING EATING BEHAVIOR AFTER EXERCISE , Kylie F. L. McFee
EXAMINING MOTIVATIONS AND BARRIERS FOR ONLINE GROCERY SHOPPING AMONG URBAN AND RURAL POPULATIONS OF KENTUCKY, NORTH CAROLINA, AND MARYLAND , J.B. Pitts
Leveraging Community Health Workers’ Expertise in the Community to Address Food Insecurity in Appalachia , Alexis Kimbro Scott
Theses/Dissertations from 2021 2021
PROCURING PRODUCE IN A RURAL, APPALACHIAN COUNTY: A THEMATIC ANALYSIS OF COMMUNITY MEMBER EXPERIENCES , Caroline Blincoe
In-store Marketing Campaign to Promote the Purchase of Healthy Foods and Beverages at Convenience Stores in Rural Kentucky , Brynnan Nicole Jacobs Dunaway
EXPLORING THE RELATIONSHIPS BETWEEN CULTURAL VALUES AND DIET PATTERNS AMONG MEXICAN AND CUBAN IMMIGRANTS IN KENTUCKY , Nasreen Omran
Assessing Self-Perceived Nutrition-Related Lifestyle Behaviors and Knowledge of University Music Students Following a Targeted Presentation , Gretchen Trumbo
Theses/Dissertations from 2020 2020
Evaluation of Kentucky Grown Soft Red Winter Wheat with Sensory Evaluation for Bread-making Capabilities and Quality , Asa Conkwright III
CARDIAC EFFECTS OF OBESITY DURING PREGNANCY IN C57BL/6J MICE , Kayla Lynn Dudick
Examining Cultural Influences on Dietary Behaviors among Mexican Americans with Low Acculturation , Austyn Erickson
Energy Compensation with Exercise is not Dependent on Dose , H. Michael Hays
AN EDUCATIONAL PILOT INTERVENTION TO INCREASE ENVIRONMENTAL HEALTH LITERACY AMONG RURAL KENTUCKY YOUTH ATTENDING SUMMER CAMP , Ashley Rose Mattingly
Advanced Search
- Notify me via email or RSS
Browse by Author
- Collections
- Disciplines
Author Corner
- Submit Research
New Title Here
Below. --> connect.
- Law Library
- Special Collections
- Copyright Resource Center
- Graduate School
- Scholars@UK
- We’d like your feedback
Home | About | FAQ | My Account | Accessibility Statement
Privacy Copyright
University of Kentucky ®
An Equal Opportunity University Accreditation Directory Email Privacy Policy Accessibility Disclosures
BYU ScholarsArchive
Home > Life Sciences > Nutrition, Dietetics, and Food Science > Theses and Dissertations
Nutrition, Dietetics, and Food Science Theses and Dissertations
Theses/dissertations from 2023 2023.
Development and Validation of a Spanish Nutrition Screening Tool for Hispanic American 3 to 5-Year-Olds , Denisse Arias Olivas
Potential Clean-Label Astringency Maskers for Acidic Whey Protein Beverages , Jozxelle Tongson Gao
Thermal Inactivation of Salmonella, Escherichia coli, and Enterococcus faecium NRRL B-2354 in Pasta Matrices , Kristi Shannon Gowans
Feasibility of RNA-Based Pathogen Detection in an Infant Formula Matrix , Gweneth Claire Gustafson
Prevalence and Predictors of Intern-Related Burnout in Dietetics Preceptors , Holly Hopkins
Utilizing Isothermal Titration Calorimetry to Measure β-galactosidase Activity in Dairy Products , Tyler Ronald Jarrard
Development of a Valid and Reliable Survey to Assess Personal, Behavioral, and Environmental Factors Surrounding Food Insecurity in a College Population , Jennette Kilgrow
A Comparison of Kid Goat Lipase and Microbial Lipase on the Development of Cheddar Cheese Flavor , Reece H. Larsen
Effect of Timing of Energy Intake on Blood Glucose and Body Composition in Women with Overweight or Class One Obesity , Michael Wade Smith
Use of Microcalorimetry to Evaluate Hardening Reactions in Protein Bars During Accelerated Storage , Tiffany Rose Spackman
Theses/Dissertations from 2022 2022
Isothermal Inactivation Studies of Listeria monocytogenes, Salmonella, and Enterococcus faecium NRRL B-2354 in Almond, Peanut, and Sunflower Butters , Ruo Fen Liao
Localized Heat Therapy Improves Mitochondrial Function in Human Skeletal Muscle , Erik D. Marchant
Amino Acids as Alternatives to Emulsifying Salts in Processed Cheese Analogues , Jeremy Thomas Pack
Effects of Microbial Transglutaminase on Gluten-Free Sourdough Bread Structure and Loaf Characteristics , Anna J. Redd
Theses/Dissertations from 2021 2021
Characterization of Bacteriophage Targeting Bacillus licheniformis in Milk Processes and Thermal Stability of Bacteriophage During HTST Pasteurization , Jeremy Robert Arbon
Current Practices in Residential Treatment of Co-Occuring Eating Disorders and Type 1 Diabetes , Megan Michelle Austin
Mixture Design Response Surface Methodology Analysis of Seven Natural Bioactive Compounds to Treat Prostate Cancer , Ian Geddes Berlin
Utilizing Isothermal Titration Calorimetry for Measuring Beta-Galactosidase Activity in Liquid Dairy Products , Eliza Anne Brock
The Beneficial Effects of The Gut-Derived Metabolite Trimethylamine N-oxide on Functional β-Cell Mass , Emily Suzanne Krueger
Ice Cream Formulation Optimization Using "Consumer-Friendly" Hydrocolloid Stabilizers , Benjamin Todd Woodward
Theses/Dissertations from 2020 2020
Metabolomics of Acid Whey Derived from Greek Yogurt , Muriel Mercedes Allen
Cronobacter sakazakii Genes Contributing to Persistencein Low-Moisture Dairy Matrices , Kaitlin Ash Hartmann
Activity, Stability, and Binding Capacity of β-Galactosidase Immobilized on Electrospun Nylon-6 Fiber Membrane , Deborah Ann Hutchins
Blend Uniformity and Vitamin Stability in Dairy-Based Foods Fortified with Lipid-Encapsulated Ferrous Sulfate , Garth Anthony Lee
Isothermal Inactivation of Salmonella, Listeria monocytogenes, and Enterococcus faecium NRRL-B 2354 in Peanut Butter, Powder Infant Formula, and Wheat Flour , Adam Robert Quinn
Dairy Milk and Plant-Based Alternative Beverage Purchasing Factors: Consumer Insights , Jeffrey Alan Rime
A Rapid Spectrophotometric Assay for Quantifying Seed Coat Saponins in Quinoa , Sydney Diver Szabo
Theses/Dissertations from 2019 2019
Leaf Fiber Strength and Fruit Nutrient Content of Yucca Species Native to the Navajo Nation , Anna Therese Bartlett
An Observational Study of Physicochemical Changes in Cheddar Enzyme-Modified Cheese During Incubation , David Gary Doxey
Sensory Acceptability and Nutrient Stability in Micronutrient-Fortified Soymilk Prepared in Small-Scale Batch Processes , Dallin Max Hardy
Theses/Dissertations from 2018 2018
Comparison of Functional, Nutritional, and Sensory Properties of Spray-Dried and Oven-Dried Cricket ( Acheta domesticus ) Powder , Fred Stephen Bassett
Carbon Dioxide Treatment on Strawberry Fruit Prep and Its Effect on Shelf Life , Bryan Sterling Dawson
Optimization of Oat Amylase During Sprouting to Enhance Sugar Production , Erin Elizabeth Hiatt
Effects of Acid Whey Marination on Tenderness, Sensory and Other Quality Parameters of Beef Eye of Round , Jason Kim
Application of Mixture Design Response Surface Methodology for Combination Chemotherapy in PC-3 Human Prostate Cancer Cells , Richard Vernon Oblad
Evaluation of Pigments from a Purple Variety of Atriplex hortensis L. for Use in Food Applications , Eva Graciela Vila Roa
Theses/Dissertations from 2017 2017
Textural, Color and Sensory Attributes of Fruits and Vegetables Dried Using Electric Forced-Air and Solar Dehydrators , Edward Wayne Crossen
Handgrip Strength in Children with Cystic Fibrosis , Hannah Taylor Gibson
Teacher Perceptions of School Breakfast Programs in Utah , Emily Breanne Krueger
Effects of GM Disclosure Statements on Consumer Perceptions of Selected Food Products in Survey and Sensory Panel Settings , Ellyn Margaret Newcomb
The Effect of Cocoa Flavanols on β-Cell Mass and Function , Thomas John Rowley
Effects of Curcumin and Ursolic Acid on the Mitochondrial Coupling Efficiency and Hydrogen Peroxide Emission of Intact Skeletal Myoblasts , Daniel J. Tueller
Correlation of SPME-GC-MS Volatile Compounds with Descriptive Sensory Odor Analysis of Whole Wheat and Quinoa Flours in Accelerated Storage , Sarah Snow Turner
Theses/Dissertations from 2016 2016
Overexpression of HDAC1 Induces Functional β-cell Mass , Carrie Draney
Comparing Steady State to Time Interval Measurements of Resting Metabolic Rate , Chelsea Jayne Irving
Malnutrition and Handgrip Strength in Hospitalized and Non-Hospitalized Children 6-14 Years Old , Kayla Camille Jensen
The Effect of Monetary Reward and Food Type on Motivation of Untrained Sensory Panelists in Triangle Tests , Jessilee Noel Loucks
Inhibition of Clostridium Perfringens Growth During Extended Cooling of Cooked Uncured Roast Turkey and Roast Beef Using a Concentrated Buffered Vinegar Product and a Buffered Vinegar Product , Andrew Mitchell Smith
Theses/Dissertations from 2015 2015
Effects of Panelist Participation Frequency and Questionnaire Design on Overall Acceptance Scoring for Food Sensory Evaluation in Consumer Central Location Tests , Mauresa Bastian
Selection and Use of Pantoea dispersa strain JFS as a Non-Pathogenic Surrogate for Salmonella Typhimurium Phage Type 42 in Flour , James R. Fudge
Folate Stability in Fortified Corn Masa Flour, Tortillas, and Tortilla Chips , Renee Phillips
Stability of Whole Wheat Flour, Rolled Oats, and Brown Rice During Long-Term Storage and Preparation , Victoria Elizabeth Scott
Evaluation of Breastfeeding Curricula in Didactic Programs in Dietetics and Dietetic Internships Across the United States , Maria Diane Swiss
Stability of Selected B Vitamins in Thermally-Treated Pinto Beans , Virginia Anne West
Theses/Dissertations from 2013 2013
Utah Red Raspberry Jam: The Effects of Formulation, Heating, and Time on Color, Flavor, Texture, and Antioxidant Capacity , Jennifer Leigh Chase
Construction and Performance Testing of a Mixed Mode Solar Food Dryer for Use in Developing Countries , Sean Andrew Foster
Emergency Preparedness in Utah Households with Emphasis on Water and Food Storage Conditions , Stephanie Rae Gerla
College Students' Fruit, Vegetable, and Sugar Sweetened Beverage Intake According to Dinner Group Participation , Erica Nicole Hansen
The Protective Effect of Antioxidants on Vitamin A Stability in Nonfat Dry Milk During Thermally Accelerated Storage , Amalie Brown Kurzer
Reading and Listening to Music Increase Resting Energy Expenditure During Indirect Calorimetry in Healthy Adults , Blaire Snell
Effect of Enrichment-Bleaching and Low Oxygen Atmosphere Storage on All-Purpose Wheat Flour Quality , Jonathan Myers Swindler
Theses/Dissertations from 2012 2012
Microflora of Traditional Mexican Corn Masa and Its Effect on Folic Acid Degradation , Stephen J. Adolphson
Exposure to Dietary Selenium and Soy Isoflavones in Utero Provides Greater Protection Against Prostate Cancer Risk Factors in TRAMP Mice than Exposure Beginning at 6 Weeks , Heather Schofield Lindsay
An Investigation of Current Practice in Management Rotations in Dietetic Internships , Emily K. Vaterlaus
Theses/Dissertations from 2011 2011
Maternal, Neonatal and Feeding Type Factors Associated with Severity of Necrotizing Enterocolitis , Cheryl Ann Miner
Changes in Fruit and Vegetable Household Food Availability Among Low-Income Families over a One-Month Period of Time , Ann Alicia Wells
Theses/Dissertations from 2010 2010
Qualitative Description of College Students' Dinner Groups , Brita Michelle Ball
The Effects of Chronic AMPK Activation on Hepatic Triglyceride Accumulation and Glycerol-3-Phosphate AcyltransferaseActivity with High Fat Feeding , Mary E. Curtis
Factors Influencing Shopping, Cooking, and Eating Behaviors Among Low-Income Families During a One-Month Period of Time , Janice Darko
Beta Galactosidose Activity of Commercial Lactase Samples in Raw and Pasteurized Milk at Refrigerated Temperatures , Trenton W. Horner
Change in Eating Competence in College Students Enrolled in Basic Nutrition Courses , Katrina J. Larsen
Effects of Duration of Proton Pump Inhibitor (PPI) Therapy on Markers of Bone Health in Men and Postmenopausal Women , Zarina Maria Pabin
Chemopreventive Effects of Dietary Selenium and Soy Isoflavones in a Mouse Model of Prostate Cancer , Trevor Elisha Quiner
Development and Use of a Physiologically Based Mathematical Model Describing the Relationships and Contributions of Macronutrients to Weight and Body Composition Changes , Saori Sakita
Accelerated Shelf Life Determination of Antioxidant Stabilized High Oleic Sunflower and Canola Oils in Plastic Bottles , Christine Nicole Shearer
Conditions Associated with Clostridium sporogenes Growth as a Surrogate for Clostridium botulinum in Non-thermally Processed Canned Butter , Reed H. Taylor
Contributing Factors to Excess Weight Gain During Pregnancy Among Low Income Women in Utah , Tianna Noelle Watson
Effect of Upward Feedback on the Gap Between Manager and Subordinate Perception of Manager Behavior , Jessica Beesley Zetterquist
Theses/Dissertations from 2009 2009
Factors Affecting Folic Acid Stability in Micronutrient Fortified Corn Tortillas , Jordan S. Chapman
Theses/Dissertations from 2008 2008
Characteristics of Volunteer Leaders in the American Dietetic Association Compared to Non-Volunteer Registered Dietitians , Samantha Payne Rasmussen
Theses/Dissertations from 2007 2007
Effect of the consumption of farm animals on the diet and hemoglobin levels of school age children in the rural communities of Topo, Imbabura, Gualabi, Calpaqui, and Compania of the Imbabura province , Alexandra Echeverría
Registered Dietitian Dress and The Effect of Dietitian Dress on Perceived Professionalism , Connie Lynn Packer
Theses/Dissertations from 2005 2005
Development of a process of addition of tricalcium phosphate from burnt phosphate rock in feed for animal nutrition , Luis Fernando Nogales Grágeda
The Effect of Religiosity and Spirituality on Transformatinal Leadership Characteristics of Hospital Food and Nutrition Managers , Anna Naegle Sarver
Theses/Dissertations from 2004 2004
Body Mass Index and Soft Drink Consumption Among Adolescents , Olivia Love McCord
The Effect of Religiosity and Spirituality on Work Practices and Trust Levels in Managers and their Subordinates in Food and Nutrition Care Departments , Jennifer S. Oler
The Effects of Selenium on Estrogen-regulated Gene Expression in LNCaP Prostate Cancer Cells , Tory L. Parker
Theses/Dissertations from 2003 2003
Determination of home techniques for storing and conserving food in the homes of Cuambo and La Rinconada in Imbabura province, 2001-2002 , Marisol Caicedo Barrios
Determination of seric retinol levels in relation to consumed diet and the prevalence of anemia in preschool- and school-aged children in the communities of Cuambo and La Rinconada, Imbabura province , Verónica Chávez
Analysis of Weight-Related Advertisements and Nutrition Articles in Popular Women's Magazines , Jennifer Cardall Jacobson
Design and application of a nutrition education program based on a test of improved practices for pregnant women and women of childbearing age in La Rinconada and Cuambo , Odila Nicaragua
The Effectiveness of Consuming Fortified Foods (API) with iron on the anemia ferropriva in resident students to great altitude of the rural area of the Departemento of La Paz , Beatriz Julia Ramirez Copa
Theses/Dissertations from 2002 2002
Elaboration of Noodles, Enriched with Kidney Bean in the Communities of Cuambo and the Rinconada of the Canton Ibarra Province of Imbabura , Irma Meneses
Theses/Dissertations from 2001 2001
Nutritional Food and Health Education with Instructive Lessons in the Community School of La Rinconada, Cantón Ibarra, Province of Imbabura , Olga Maria Gómez Chirán
Eating, Nutrition and of Health Diagnostic of the Elementary Schools of the Communities of Guambo and the Rinconada, Province of Imbabura 2002-2001 , Ruth Muriel
Food, nutrition, and health education with educational lessons in the Cuambo community school, Ibarra canton, Imbabura province , Fanny Margoth Victoria Recalde
Theses/Dissertations from 2000 2000
The Availability and the Use of Basic Services in Relation to the Nutritional Status, Acute Diarrhetic Diseases and Acute Respiratory Infections in Children Under five Years of Age in Three Rural Communities of the Imbabura Province during the 1998-1999 Period , Margarita Caicedo Ceron
Elaboration and Validation of the Educational Material Used in Nutritional Education in the Communities of Copalacaya, Choquenaira, Callisaya, and Muruamaya, of the Providence Ingavi of the Department of La Paz 1998 , Maria Isabel Mercado Miranda
Relation between Internal Parasites with Basic Services and the Nutritional Status of Children Five Years of Age in the Indigenous, Black and Mestizo Communities of the Rural Area, Imbabura Province , R. Patricio Paguay Ruiz
Relationship between intestinal parasitosis with the basic services, and the nutritional state of children under the age of five of black, native, and mestizo ethnicities in the rural area of the province of Imbabura 1998-1999 , Carlos Rosero
Advanced Search
- Notify me via email or RSS
ScholarsArchive ISSN: 2572-4479
- Collections
- Disciplines
- Scholarly Communication
- Additional Collections
- Academic Research Blog
Author Corner
Hosted by the.
- Harold B. Lee Library
Home | About | FAQ | My Account | Accessibility Statement
Privacy Copyright
Nutrition Research Topics: An Extensive List
For years, we've followed food pyramids and counted calories, but the science of nutrition keeps surprising us. Researchers are now finding exciting connections between what we eat and how we feel.
This article covers the latest trends in dietary studies, presenting over 200 fascinating nutrition research topics for college students. These areas look into the incredible potential of food to transform our health, our environment, and even how we think about what we put on our plates. You'll discover topics that ignite your interest and show you the amazing influence food can have.
The List of 200+ Nutrition Research Topics
If you're fascinated by the impact of food and where nutrition research is headed, explore the list below. These topics cover everything from personalized diet plans to building sustainable food systems, offering something for anyone passionate about food and health.
Is Your Nutrition Research Paper Giving You Heartburn?
Don't get bogged down by endless sources and complex arguments! Our expert writers are here to be your lifesaver.
Research Topics for Nutrition Students
- Does eating breakfast improve academic performance in students?
- Can following a specific diet help manage symptoms of anxiety or depression?
- How does staying hydrated affect athletic performance?
- Is there a difference in the nutritional value of organic and conventionally grown produce?
- Do certain foods or food combinations boost the immune system?
- How can we encourage healthy eating habits in children?
- Does skipping meals lead to weight gain or weight loss?
- Are there effective ways to reduce sugar intake without sacrificing taste?
- Can dietary changes help improve sleep quality?
- How does the gut microbiome influence overall health?
- Are there sustainable ways to combat food insecurity in communities?
- What are the potential benefits and drawbacks of popular dietary trends? (e.g., Ketogenic diet)
- How can food labels be improved for better consumer understanding?
- Does the type of fat we consume significantly impact our health?
- Is there a link between diet and the risk of developing chronic diseases?
Check out our interesting list of mental health research topics in a separate guide.
Latest Research Topics in Nutrition
- Intermittent Fasting Benefits: Can personalized intermittent fasting approaches improve weight management, metabolic health, and overall well-being?
- Postbiotics for Gut Health: Are postbiotics (byproducts of beneficial gut bacteria) a promising new approach to improving gut health and digestion?
- Personalized Vitamin D Needs: Does optimizing vitamin D intake based on individual needs offer greater health benefits compared to a one-size-fits-all approach?
- Dietary Fiber & Cognitive Decline: Can increasing dietary fiber intake help prevent or slow cognitive decline associated with aging?
- Mindful Eating for Binge Eating: Can mindfulness-based interventions effectively reduce the frequency and severity of binge eating episodes?
- Food Addiction Research: Is food addiction a real phenomenon, and if so, how can dietary and behavioral strategies be used to manage it?
- Prebiotics & Mental Health: Does prebiotic supplementation have a positive impact on mental health by influencing the gut microbiome?
- Omega-3 Fatty Acids & Brain Health: Can increasing omega-3 fatty acid intake from fish or plant sources improve cognitive function and brain health?
- Sugar Substitutes & Weight Management: Are sugar substitutes a safe and effective tool for weight management, or do they have unintended consequences?
- Personalized Sleep & Nutrition: Can sleep patterns be factored into personalized nutrition plans to optimize health outcomes?
- Vertical Farming & Sustainability: Can advancements in vertical farming technology contribute to a more sustainable and local food system?
- Food Waste Solutions: How can innovative technologies and practices be used to reduce food waste throughout the food production and consumption chain?
- Urban Agriculture & Community Health: Can urban agriculture initiatives improve access to fresh produce and promote healthy eating habits in underserved communities?
- Plant-Based Meat Alternatives: With the rise of plant-based meat alternatives, how can research ensure these products are nutritionally equivalent to traditional meat options?
- Foodborne Illness Outbreaks: How can new technologies and improved tracking systems be used to prevent and rapidly identify foodborne illness outbreaks?
Hot Topics in Nutrition Research
- With more processed foods, are we missing essential vitamins and minerals? How can we address these deficiencies?
- Can healthier soil lead to more nutritious and eco-friendly food?
- Can the elimination diet identify gut triggers and improve digestion?
- Can microbes create new foods like plant-based cheese and sustainable protein sources?
- Can adding probiotics, prebiotics, and antioxidants to food make it even healthier?
- How do polyphenols in berries and green tea influence gut health?
- What are the metabolic effects of fermented foods rich in probiotics?
- Can personalized nutrition based on microbiome analysis improve IBS symptoms?
- How does the Mediterranean diet reduce inflammation linked to chronic diseases?
- What are the cardiovascular benefits of omega-3 fatty acids from different sources?
- What are the health impacts of alternative proteins like insect-based or lab-grown meats?
- How does protein timing affect muscle synthesis in older adults?
- Do exogenous ketone supplements enhance athletic performance and recovery?
- How do spices like turmeric and ginger influence inflammation and immune function?
- Can mindful eating practices improve stress-related dietary behaviors?
Nutrition Research Topics for College Students
- Does dorm life hurt healthy eating?
- Can diet improve sleep for stressed students?
- Can students eat healthily on a tight budget?
- What strategies can help students avoid weight gain?
- Can specific foods help students focus and learn better?
- How does social media influence college food choices?
- Does meal prepping save money and keep students healthy?
- What nutrients do college athletes need to perform their best?
- Why are plant-based diets gaining popularity in colleges?
- Are energy drinks a healthy choice for students?
- How can we teach college students to eat well?
- Does gut health affect stress and anxiety in college students?
- Is the food you eat produced sustainably?
- How can we reduce food waste on campus?
- How will new food technology impact what college students eat?
For various research topic ideas for students , we've put together an extensive list in the detailed article.
Sports Nutrition Research Topics
- Does a specific pre-workout meal improve athletic performance?
- How much carbohydrates are best for endurance athletes?
- Does extra protein after exercise help muscles recover faster?
- How much water is optimal for athletes during training?
- Do electrolyte drinks improve performance in hot weather?
- Does getting enough sleep impact athletic performance?
- Does caffeine enhance focus and energy for athletes?
- Do beetroot supplements improve athletic performance?
- Can specific foods or supplements improve mental focus during competition?
- Can plant-based athletes achieve optimal performance?
- Do specific dietary needs exist for different types of athletes?
- What are the most effective post-workout meals for muscle repair?
- Do popular sports supplements actually deliver on their promises?
- Does gut health impact athletic performance or recovery?
- Can personalized nutrition plans further optimize athletic performance?
Clinical Nutrition Research Topics
- Sepsis & Gut Microbiome: Does gut bacteria composition in critically ill patients influence their response to feeding through a tube (enteral feeding)?
- Gestational Diabetes Diet: Can a personalized low-sugar diet improve outcomes for moms and babies compared to a standard diabetic diet?
- Nutrition After Brain Injury: Does early nutritional support after a head injury impact long-term thinking and recovery?
- Chemo & Gut Health: Can a specific combination of prebiotics and probiotics reduce diarrhea caused by chemotherapy in cancer patients?
- Sarcopenia & Muscle Building: Does a high-protein diet with strength training help older adults build muscle mass (sarcopenia)?
- Heart Disease & Diabetes Diet: Does a Mediterranean diet with added fish oil provide more heart protection for people with type 2 diabetes compared to a standard diabetic diet?
- Crohn's Disease & Diet: Can a specific elimination diet with nutrition advice improve symptoms and reduce medication use in children with Crohn's disease?
- Carbs & Athlete Performance: Does a personalized carb intake plan based on individual sugar response improve performance in high-intensity endurance athletes compared to a general plan?
- Telemedicine Nutrition: Can a nutrition education program delivered remotely be as effective as in-person counseling for weight management in pre-hypertensive adults?
- Protein Timing & Muscle Recovery: Does the timing of protein intake (throughout the day vs. after workout) affect muscle building and recovery in older adults?
- Kidney Disease Diet: Can a personalized low-potassium, low-phosphorus diet with supplements improve kidney function and delay dialysis in people with chronic kidney disease?
- Immune-Modulating Nutrition After Surgery: Does using enteral feeding with specific immune-boosting nutrients reduce complications after major surgery?
- PCOS & Inositol: Can combining dietary changes with inositol supplements improve menstrual regularity and insulin sensitivity in teenagers with PCOS compared to lifestyle changes alone?
- Plant-Based Protein for Athletes: Can a plant-based diet with whole grains, legumes, and nuts provide enough protein for muscle growth in strength-training athletes compared to a meat-eating diet?
- Celiac Disease & Personalized Nutrition: Can a personalized nutrition plan with genetic testing for nutrient absorption improve adherence to a gluten-free diet and health outcomes in people with celiac disease?
Advances in Food Technology and Biotechnology
- CRISPR Fruits & Veggies: Can gene editing create more nutritious produce with higher vitamins or reduced allergens?
- Lab-Grown Meat: Can lab-produced meat from stem cells be a sustainable and ethical alternative to traditional meat production?
- Vertical Farming for All Seasons: Will advancements in vertical farming allow for year-round local food production even in cities?
- 3D Printed Personalized Meals: Is 3D food printing a solution for personalized nutrition, creating meals tailored to individual needs and preferences?
- Natural Biopreservatives: Can natural preservatives derived from microorganisms extend the shelf life of fresh produce and reduce food waste?
- Biosensors for Food Safety: Will biosensors allow for rapid on-site detection of foodborne pathogens, improving food safety?
- Intelligent Food Packaging: Can nanotechnology create intelligent packaging that monitors food quality and spoilage?
- Fermentation for Protein: Can fermentation techniques create new and sustainable protein sources from insects or algae?
- Precision Fermentation for Dairy: Is precision fermentation a viable approach to producing dairy products like cheese without animals?
- Encapsulation for Targeted Nutrition: Will advancements in encapsulation technologies allow for targeted delivery of micronutrients and bioactive compounds in food?
- AI for Optimized Food Production: Can AI optimize food production processes, minimizing waste and maximizing efficiency?
- Robotics in Food Processing: Are there possibilities for using robotics in food processing and packaging to improve accuracy and reduce foodborne illness risks?
- Plant-Based Sweeteners: Could the development of alternative sweeteners derived from plants or microorganisms provide healthier and more sustainable options?
- Biodegradable Food Packaging: Will advancements in bioplastics allow for the creation of eco-friendly food packaging that biodegrades after use?
- Genome Sequencing for Pest-Resistant Crops: Can whole genome sequencing help develop crops that are more resistant to pests and diseases?
Food and Nutrition Research Topics
- Do organic fruits and vegetables offer significantly more health benefits compared to conventionally grown ones?
- How does the sugar content of different breakfast cereals impact children's energy levels and focus throughout the morning?
- Is there a link between spicy food consumption and pain management?
- Can the addition of specific herbs and spices to a diet help reduce salt intake without sacrificing flavor?
- Does the order in which you eat foods during a meal affect nutrient absorption?
- How effective is meal prepping for promoting healthy eating habits and weight management?
- Is there a difference in the nutritional value of fresh versus frozen fruits and vegetables?
- Can mindful eating practices improve digestion and overall gut health?
- Does the timing of caffeine intake throughout the day influence sleep quality?
- How do social media advertising and marketing impact food choices, particularly among teenagers?
- Is there a connection between gut health and mental well-being?
- Can food insecurity contribute to the development of chronic diseases?
- How effective are food labeling systems in helping consumers make informed dietary choices?
- Does cultural background influence dietary habits and preferences?
- Is there a role for personalized nutrition apps in promoting healthy eating behaviors?
Have you already chosen a great topic and are now thinking, ' Can I pay someone to write my paper ?' Stop scratching your head, and send us your request!
Animal Nutrition Research Paper Topics
- Can food waste be a viable and sustainable feed source for chickens?
- Do prebiotics and probiotics improve gut health and performance in dairy cows?
- How does omega-3 supplementation affect the quality of pork meat?
- Are insects a nutritious and sustainable alternative protein source for fish farming?
- Can alternative proteins like algae or mycoprotein replace traditional sources in pet food?
- Does dietary fiber content impact how horses digest and absorb nutrients?
- Can a personalized nutrition plan optimize growth and nutrient use in pets?
- How does heat stress affect feed intake and nutritional needs in chickens?
- Can adjusting diet boost the immune system of farmed fish to fight diseases?
- What feeding strategies for ruminant animals (like cows and sheep) are most environmentally friendly?
- Do fermented feeds improve feed utilization and reduce methane emissions in sheep?
- Does a horse's early diet affect its long-term health and racing performance?
- Can we create a cost-effective feed formula for sustainable livestock production in developing countries?
- How does grazing management affect the availability of nutrients for grazing animals?
- Can new feed additives help reduce antibiotic use in poultry production?
PhD Research Topics in Food and Nutrition
- Gut Microbiome & Personalized Diets: Can gut manipulation through diet improve health and prevent chronic diseases?
- AI in Food Production: Can AI reduce food waste while maintaining nutritional quality?
- Nutrigenomics in Action: How can nutrigenomics research translate into personalized dietary strategies for optimal health?
- Diet & Neurodegenerative Diseases: Is there a link between diet and diseases like Alzheimer's or Parkinson's?
- Functional Foods & Chronic Inflammation: Can bioactive compounds in foods manage inflammation and improve health?
- Food Policy for All: How can food policies create equitable access to healthy and sustainable food systems, especially in developing countries?
- Early Nutrition & Long-Term Health: How does early childhood nutrition impact cognitive development, academic performance, and future health?
- Culturally Sensitive Personalized Nutrition: Can personalized plans considering cultural preferences promote healthy eating in diverse populations?
- Food Packaging Innovation: Can packaging technology extend shelf life, reduce spoilage, and be more environmentally friendly?
- Ultra-Processed Foods & Allergies: Does eating ultra-processed foods contribute to food allergies and autoimmune disorders?
- GMO Ethics: What are the ethical considerations surrounding genetically modified organisms (GMOs) in food production?
- Telemedicine & Nutrition: Can telemedicine and mobile health create effective remote nutrition counseling and management?
- Climate-Resilient Food Systems: How can the global food system become more resilient to climate change and ensure food security for future generations?
- Gut-Brain Axis & Mental Health: Does the gut-brain connection influence mood, anxiety, and depression? Can diet help?
- Emerging Food Technology: What are the potential benefits and risks of CRISPR gene editing and 3D food printing for human health and food security?
Pediatric Nutrition Research Topics
- Early Flavor Exposure & Picky Eating: Does exposure to diverse flavors in infancy prevent picky eating later?
- Personalized Nutrition for Kids: Can genetic plans improve growth and development compared to a general approach?
- School Meals & Childhood Obesity: Does participation impact obesity rates and dietary quality in elementary school children?
- Breastfeeding & Allergies: Is there a link between breastfeeding duration and food allergies or eczema in infants?
- Screens at Meals & Kids' Weight: How does smartphone use during meals affect children's eating habits and weight management?
- Mindfulness & Healthy Eating in Kids: Can mindfulness training in schools promote healthy eating and reduce emotional eating?
- Family Nutrition Education & Cooking: Does combining nutrition education and cooking classes improve family diets and reduce childhood obesity risk?
- Sugary Drinks & Kids' Brains: How does sugary drink consumption impact children's cognitive function and academic performance?
- Micronutrients & ADHD: Can specific dietary interventions improve cognitive development in children with ADHD?
- Sleep & Kids' Food Choices: Does sleep quality influence children's food choices and dietary patterns?
- Childhood Obesity & NAFLD: Is there a link between childhood obesity and developing non-alcoholic fatty liver disease in adolescence?
- Social Media & Healthy Choices: Can social media marketing target children to promote healthy eating and reduce unhealthy snacking?
- Gut Microbiome & IBD in Children: How does the gut microbiome in children with inflammatory bowel disease differ, and can diet influence it?
- Sports & Teen Athletes' Diets: Does participation in sports or extracurricular activities influence adolescent athletes' nutritional needs and dietary practices?
- School Programs & Eating Disorders: Can school-based programs promoting healthy eating and physical activity prevent eating disorders in teenagers?
Public Health Nutrition Research Topics
- CSA Programs & Low-Income Access: Do they increase access to fresh produce in low-income neighborhoods?
- Social Marketing & Healthy Eating: Can campaigns promote healthy habits and reduce sugar consumption?
- Restaurant Menu Labels: Do they influence consumers towards healthier choices?
- Food Insecurity & Chronic Disease: Is there a link between not having enough food and health problems?
- Food Vouchers & Healthy Choices: Do they encourage healthy eating in low-income families?
- School Breakfast & Learning: Do breakfast programs improve academic performance and attendance?
- Food Fortification & Public Health: Does adding nutrients to foods improve health in developing countries?
- Sugar Awareness Campaigns: Can public education campaigns reduce children's sugar intake?
- Food Marketing & Diet: How do government regulations on food advertising impact young people's eating habits?
- Workplace Meals & Diet Quality: Does access to healthy workplace meals improve dietary quality for working adults?
- Food Deserts & Obesity: Is there a link between lack of fresh food stores and obesity rates?
- Culturally Sensitive Nutrition: Can tailored interventions address dietary needs in diverse populations?
- Food Banks & Healthy Habits: Can food assistance programs promote healthy eating alongside food aid?
- Mobile Health Apps & Nutrition: Do nutrition apps improve public health outcomes?
- Combined Health Initiatives: Can programs promoting healthy eating and physical activity work better together to prevent disease?
Research Topics in Nutrition and Dietetics
- Mediterranean Diet with Nuts & Seeds: Does it offer more heart health benefits than a standard version?
- Personalized Intermittent Fasting: Can it improve weight management and overall health based on individual metabolism?
- Low-Carb & Exercise for Diabetes: Does it control blood sugar better than a traditional diabetic diet?
- Athlete's Gut Microbiome: How does it influence performance and recovery?
- Fermented Foods & Gut Health: Do they improve gut health and reduce digestive disorders?
- Fiber & Cognitive Function: Is there a link between fiber intake and brain function in older adults?
- Plant-Based Protein for Muscle: Can a plant-based diet with whole grains and legumes build muscle mass?
- Protein Timing & Muscle Growth: Does protein intake timing (morning vs. evening) impact muscle growth and recovery?
- Plant Sterols & Cholesterol: Can dietary changes combined with plant sterols lower LDL cholesterol?
- Mindfulness & Eating: Does mindfulness meditation before meals promote mindful eating and reduce emotional eating?
- Food Delivery Apps & Diet Quality: Do they impact dietary choices and overall diet quality in young adults?
- Personalized Nutrition & Adherence: Can a plan based on taste and genetics improve adherence to a healthy diet?
- Vitamin D & Autoimmune Disease: Is there a link between vitamin D deficiency and autoimmune diseases like rheumatoid arthritis?
- High-Glycemic Diet & CFS: Does a high glycemic index diet contribute to chronic fatigue syndrome (CFS)?
- Diet & Exercise for PCOS: Can a combination of dietary modifications and exercise manage polycystic ovary syndrome (PCOS) symptoms?
Nutrition and Exercise Research Topics
- HIIT vs. Moderate Exercise: Does high-intensity burn more calories and fat in less time?
- Strength Training & Protein: Can it build muscle and bone density in older adults?
- Music & Exercise: Does listening to music boost motivation and performance?
- Sleep & Exercise: How does sleep quality impact recovery, muscle growth, and athletic performance?
- Yoga/Tai Chi for Stress: Can they manage stress and improve emotional well-being?
- Pre-Workout Snack: Do specific nutrients enhance exercise performance and endurance?
- Vitamin D & Muscle Strength: Is there a link between supplementation and improved muscle function?
- Personalized Workouts: Do tailored exercise programs lead to better results than generic routines?
- Nature Exercise & Mental Health: Does exercising outdoors offer additional mental health benefits?
- Mindfulness & Exercise: How does mindfulness impact focus and enjoyment during workouts?
- Wearable Trackers & Motivation: Can personalized trackers motivate people to exercise more?
- Fiber & Resistance Training: Does this combo improve blood sugar control in type 2 diabetes?
- Hydration & Exercise: Is staying hydrated crucial for exercise performance, especially in hot weather?
- Group Fitness Classes: Do they promote social interaction and long-term exercise adherence?
- Healthy Fats & Exercise: Do fats like avocado or nuts improve satiety and reduce post-workout cravings?
Community Nutrition Research Topics
- Urban Gardens: Do they boost access to fresh produce and healthy eating habits?
- Community Center Cooking: Can classes teach low-income families affordable, healthy meals?
- CSA Programs: Do they increase fruit and veggie intake in young families?
- Culturally Sensitive Nutrition Education: How effective is it for diverse communities?
- Mobile Meal Planning Apps: Can they promote healthy eating in under-resourced areas?
- School & Community Nutrition Teams: Do they have a stronger impact on children's diets?
- Accessible Farmers' Markets: Can they make healthy choices affordable for low-income residents?
- Healthy Stadium Food: Do healthier options influence what fans eat at sporting events?
- Workplace Wellness Programs: Do they improve employee health through nutrition and food options?
- Healthy Restaurant Collaborations: Do partnerships increase consumer demand for nutritious meals?
- Social Media & Healthy Eating: Can targeted campaigns change specific groups' eating habits (teens, seniors)?
- Food Pantries with Fresh Options: Can they offer more nutritious food alongside staples?
- Faith-Based Cooking & Nutrition Education: Does it promote healthy eating in religious communities?
- Public Transportation & Food Access: Can better design improve access to grocery stores and markets?
- Community Gardens as Learning Labs: Can they teach kids about healthy choices and sustainable food production?
Interesting Nutrition Topics for Research Paper
- Do herbs and spices promote gut health?
- Does the brewing method impact coffee's health benefits?
- Do fortified foods actually deliver on their functional food claims?
- Are natural sweeteners a better choice for blood sugar control than artificial ones?
- Can mindful eating improve our relationship with food?
- Do culinary and medicinal mushrooms offer health benefits?
- Can we reduce food waste throughout the entire food chain?
- Is breakfast truly the most important meal of the day?
- How does meal prep compare to delivery services in terms of nutrition?
- Does the gut microbiome, influenced by probiotics, impact our overall health?
- Is the hype around superfoods real, or just a fad?
- Can diet choices influence our mood and brain function?
- How can we maintain healthy eating habits across different cultural traditions?
- How will technologies like 3D printing and vertical farming change food systems?
- How can people with food allergies and intolerances navigate a world of food abundance?
How To Write A Research Paper On Nutrition
The world of food and health is full of fascinating questions! If you're writing a paper on nutrition research, it can feel like a big task – where do you even begin? But don't worry, you can follow these steps:
Step 1: Find your focus
- Take a look at the exciting research areas highlighted in this article. Maybe the potential of gut bacteria or the impact of personalized diets catches your eye.
- Real-world connections can be a great springboard for your research topic. So, think about your personal experiences or recent news stories.
- Don't be afraid to let your ideas flow freely! Write down any questions you have about food and nutrition, no matter how unusual they seem.
Step 2: Write your paper
Once you have a general area of interest, it's time to narrow your focus and develop a clear research question. Here's how:
- Specific Question: Instead of a broad question like "Does diet affect gut health?", a more focused question could be "Can a high-fiber diet increase the diversity of gut bacteria in adults?"
- Hypothesis: Based on your research question, what do you expect to find in your research?
Step 3: Build a strong structure
Section 📖 | Description 📝 |
---|---|
Abstract 📝 | Brief summary of the research question, methods, results, and conclusions. |
Introduction 📚 | Introduce nutrition broadly, focus on the specific research question, and explain its importance. |
Literature Review 📖 | Summarize relevant findings from credible sources. |
Methodology 🔬 | Explain research methods (may not need separate heading). |
Results 📊 | Present findings clearly, using tables or figures. |
Discussion 💬 | Analyze the results' significance and discuss study limitations. |
Conclusion 🔍 | Summarize findings and emphasize the research question's importance. |
References 📚 | List all sources in APA, MLA, or similar style. |
Final Thoughts
This article has just scratched the surface of the exciting research happening right now. From personalized diets to the influence of gut bacteria, the possibilities for using food to improve our lives are truly remarkable. So, what does this mean for you? Here are a few takeaways:
- Food is personal: There's no one-size-fits-all answer when it comes to nutrition.
- Embrace the power of food: Food can be a powerful tool for promoting health and well-being.
- Stay curious: Keep an open mind and be willing to learn about the latest research findings.
Remember, if you need writing help, we're always here for you. No matter what topic you choose to study, our research paper writer services are ready to back you up!
Struggling to Write Your Research Paper?
Don't worry! Our expert writers can create a great paper for you, covering everything you need.
How Do I Choose a Nutrition Research Topic?
What is the best topic for research about food, what are the 3 types of nutrition studies.
Annie Lambert
specializes in creating authoritative content on marketing, business, and finance, with a versatile ability to handle any essay type and dissertations. With a Master’s degree in Business Administration and a passion for social issues, her writing not only educates but also inspires action. On EssayPro blog, Annie delivers detailed guides and thought-provoking discussions on pressing economic and social topics. When not writing, she’s a guest speaker at various business seminars.
is an expert in nursing and healthcare, with a strong background in history, law, and literature. Holding advanced degrees in nursing and public health, his analytical approach and comprehensive knowledge help students navigate complex topics. On EssayPro blog, Adam provides insightful articles on everything from historical analysis to the intricacies of healthcare policies. In his downtime, he enjoys historical documentaries and volunteering at local clinics.
- Food & Nutrition Research . (n.d.). Foodandnutritionresearch.net . https://foodandnutritionresearch.net/index.php/fnr
- American Society for Nutrition . (2019). American Society for Nutrition. https://nutrition.org/
- thesis help
- topics to stay away from
- developing a strong topic
- education thesis prompts
- marketing problems to explore
- writing on anaesthesia
- health & psychology
- learning & development
- nursing education problems
- sports history topics
- risk management problems
- writing about wildlife
- good topics on nutrition
- writing on emotional intelligence
- good topics in astrophysics
- great topic suggestions
- dissertation topics in law
- computer engineering topics
- thesis topic solutions in finance
- IR dissertation titles
- Art dissertation topic ideas
- Environmental law thesis title
- Picking topics on interior design
- Business topic ideas to explore
- Chemical engineering topics
- Graphic design thesis titles
- 15 topics on pediatric nursing
- Ideas about network security
- Topics on structural engineering
- Economics dissertation topics
- Selection of topics in finance
- Financial markets topic ideas
- Women's studies thesis topics
- deciding on a title
- the secrets of good writing
- writing a thesis in 5 steps
- structuring your paper
- medical paper samples
- Master's paper samples
- writing a purpose statement
- writing a literature review
- PhD thesis methodology
- Doctoral thesis formatting
- tips for undergraduates
- creating a law dissertation
- writing a medical college thesis
- drafting the conclusion
- PhD thesis paper writing hints
- MBA dissertation writing tips
- A thesis on Martin Luther King
- A thesis paper in criminal justice
- Getting a custom dissertation
- Writing a proposal in history
- How to format a cover page
- Finding a finance thesis sample
- APA format bibliography section
- How to make in-text citations
- Marketing thesis writing guide
- Preparing a defense presentation
- Getting a biology thesis sample
- Marketing dissertation proposal
- Purchasing a thesis on the web
- Writing on evaluation of training
- APA thesis acknowledgements
- Using a dissertation database
- Order a dissertation safely
- writing services
The Top 20 Good Thesis Topics On Nutrition
Nutrition is the bedrock of a healthy state of body and mind. It works as an armour that protects the body from being in a fragile condition. Several nutritionists and researchers are always on the look out to make the world aware of what nutrition is all about. And this brings us to the top twenty thesis topics:
- How well do we understand Nutrition - This topic is all about identifying with the common fads about nutrition and making oneself aware of the essentials.
- Common digestive problems and its causes-Heartburn or Gastro Esophageal Reflux Disease (GERD), diarrhea, hemorrhoids, gastritis, constipation Irritable Bowel Disease (IBS) and gallstones are the common disorders, other than these there are Crohns disease, ulcerative disorders etc.
- The health quotient of starch and fibres- One can concentrate on the types of starch which are healthy and that intake of fibres triggers digestion.
- Health benefits of lipids- How Lipids reserve energy and help in the formation of cell membranes? What prevents the functions of lipids?
- Vegetarian diet: Dealing with the efficiency and deficiency of it.
- How do body responds to binge eating and fasting?
- Diseases associated with increasing fat in the body
- Being underweight is not a boon but a curse- Through this one could address the diseases caused by being underweight.
- The role of antioxidants in preventing diseases
- Calcium and how it prevents osteoporosis
- Benefits of phytochemicals and functional foods- Through this research topic one can throw light on how phytochemicals, which ideally help plant, help humans? And which food items are termed functional foods?
- Foetal alcohol syndrome- FAS is very commonly seen in case of babies whose mothers were alcoholic during pregnancy. The topic could deal with questions like how fast alcohol permeates the womb. What type of cognitive and mental disorder affect the foetus?
- The connect between Childhood obesity and chronic diseases
- Nutritional genomics- This multidisciplinary field of science has raised several questions like how food affects our genes. And how these genetic differences in individuals respond to food nutrients?
- Nutrition develops immunity system- This topic promises a lot of scope. There is an interdependence between Immunity system and nutrition and this provides a thriving ground for research topics.
- Enteral nutrition and inborn errors of metabolism
- Nutrition: A treatment of multiple organ failure- Recent research has focussed on the breakdown of protein in case of multiple organ failure.
- Allergy and Nutrition- Nutrition is making up for the paucity of certain minerals and vitamins that a certain body is rejecting.
- Cardiometabolic syndrome-This is directly linked to nutrition as there are certain components in food which induces this syndrome.
- Nutrition helps people with feeding disabilities- Nutritious food help prevent gastroesophageal reflux, this is where nutritional therapies come into play.
Popular Blogs
Tips and tricks.
- Thesis proposal sample related to tourism
- Where to get affordable assistance
- Crafting the introductory section
- 5 places to get free samples
- A winning results section
- Writing a paper in physics
- Where to find sample Master's proposals
- MBA dissertation proposal examples
- Discovering US history topics
- How to stay on the right track
- Free dissertation prospectus examples
- Working on an HRM degree paper
- APA formatting instructions
- Getting a dissertation template
- Creating a solid paper in a month
- Hiring a dissertation writer
- Writing a report on marketing
- Writing an introduction
- 3 places to get MBA paper samples
- How to buy papers at a low cost
- Professional thesis writing manual
- Creating the discussion section
- Searching for thesis paper writing help
- Where to find someone who will do my thesis
- Organizing a law thesis methods section
- Studying history questions
- PhD paper prospectus samples
- Custom writing services
- How to select an academic writing company
- Acknowledgement templates
- Geography thesis conclusion section
2024 ©. All Rights Reserved. Morey-Editions.com.
200 Unique Nutrition Research Topics for Students of All Levels
Nutrition research holds immense importance in advancing our understanding of the link between food and health. A well-chosen research topic plays a pivotal role in this process, as it fosters curiosity, drives critical thinking, and contributes to the body of knowledge in the field.
A compelling topic enables students to apply their knowledge, develop research skills, and contribute significantly to nutrition science, ultimately driving positive change in dietary practices and informing public health policies.
Table of Contents
Comprehensive Lists of Impressive Nutrition Research Topics
These lists allow researchers to explore up-and-coming areas like personalized nutrition, look into how food processing affects nutrients, and more. Something the writers working with professional Medical writing services will love to go with.
Interesting Nutrition and Exercise Research Topics
If you’re looking for something interesting that will keep your readers engaged and debating, check out this list of interesting research topics in nutrition:
- An application of metabolomics to epidemiology can be found here.
- Providing nutritional care and disease management with particular emphasis on enteral and parental nutrition
- Nutrition as a means of preventing cancer
- The challenges that food companies face in terms of regulatory standards and competitiveness
- Studies on the therapeutic Role of diet in the treatment of chronic diseases
- A review of nutritional factors based on physical activity levels, socioeconomic factors, and demographic characteristics
- The importance of healthy eating habits to your physical and mental well-being and how they can help you
- Sleep and height growth in children: Is there a causal relationship between the two?
- Consumption of alcohol and tobacco may be linked to breast cancer and other types of cancer.
- Work and breastfeeding are a mother’s responsibility.
- Development of innovative solutions to meet the challenges of sustainable food resource development
- The sustainability of food production in the world today
- A healthy diet and high quality of life
- What is the most effective way to adapt healthy habits to your lifestyle?
- Healthy eating habits can prevent chronic diseases from occurring.
- Maximizing the nutritional, sensory, functional, and safety characteristics of the food that we consume
- Menopause age and cardiovascular risk during the aging process
- The longitudinal relationship between cognitive and motor Performance and how nutrition can influence it to perform at its peak can be explored.
- An accelerometer and a questionnaire were used to measure physical activity levels.
- A study on the early determinants of whether children prefer protein from animals or protein from vegetables
- Identifying and assessing the causes of early childhood food allergies in children
- The problem of malnutrition in children
- Infectious diseases and various other conditions can be treated with nutritional support.
Trendy Nutrition Topics to Research
Want to keep up with the trends while you writing a research paper ? Go with picking up a topic from this list of research topics about nutrition.
- An analysis of the determinants and states of health based on a typology
- After the age of 50, several factors contribute to frailty
- Health effects of outdoor air pollution on humans: a study of associations
- Oxidative stress plays an imperative role in the function of biological markers
- Cleaning and disinfecting products in the workplace can result in occupational exposure
- Depending on your social group, how often you use food, and how it affects your general eating habits
- Role of a healthy diet in a brilliant mental health
- Treating infertility through medical means
- Young adults using electronic cigarettes and the factors associated with their use are discussed in this article
- The environments in which we live have an effect on our stress levels in everyday life
- Identifying nutritional exposures and assessing their impact
- Biobanking of nutritional exposures; estimation of nutritional exposures
- Nutritional markers with a high level of stability
- A revolutionary method of analyzing nutritional problems based on innovative statistical methods and big data
- How can eating well improve our lives?
- Researching public health and nutrition issues using experimental and epidemiological approaches
- An assessment of the impact of public health nutrition strategies can be done using theoretical systems
- Public health nutritional strategies that may have a positive impact on public health
- Public health epidemiology and evaluation are critical aspects of public health
- There are several mechanisms involved in the relationship between nutrition and health
- Nutrition and health are interconnected through the mechanism of nutrient absorption
- A novel approach to determining dietary habits based on innovative determinants
- Nutrient exposures and behaviors in emerging and underexplored populations
New Research Topics in Nutrition
This list of new topics will certainly give you an edge to impress your professor. Here you go with the list.
- Eating disorders are caused by a variety of factors
- Families play a critical role in the treatment of eating disorders
- Role of the family as the reason for eating disorders
- Eating disorders associated with sociocultural values
- Eating disorders caused by difficulties with physical health and fatigue
- Several psychological factors influence eating disorders
- An overview of the methodology for measuring eating disorders with measuring instruments.
- A brief description of anorexia nervosa and its characteristics.
- An overview of the definitions and characteristics of eating disorders.
- Eating disorders being reported by the patient
- The results of a survey conducted between three different colleges concerning eating disorders
- A study of food disorders and their relation to the environment is presented below
- The definition and characteristics of bulimia can be found in the following document
Fitness and Nutrition Research Topics
Pick a topic from this list to get a chance to research the world of fitness and nutrition. Here you go with the list:
- Overview of the History of Fitness and Nutrition
- After childbirth, what Role does fitness play in a woman’s life?
- Relationships between the fitness industry and the nutritional industry
- The Role of Fitness in the Health of the Public as a Whole
- What is the ideal number of fitness centers per 100 square kilometers, and where should they be located?
- How can nutrition influence hormones in college students and prevent unhealthy eating habits?
- Where to get guidance regarding fitness and precision nutrition?
- An overview of the technological developments occurring in the fitness industry as well as their relation to nutrition
- Weightlifters’ relationships with their bodies and their interaction with each other
- The practice of fitness is of interest to women: The rising trend of women’s gyms
- Taking part in fitness activities and meeting other people: A great source to socialize and release mental pressure
- Chronic diseases in college students accumulated with disordered eating habits
- Exercise as a means of combating stress and anxiety
- What are the reasons for practicing fitness exercises?
- The importance of exercise and proper nutrition in slowing down premature aging
- Pregnant women can benefit from fitness and nutrition during their pregnancy
- Number of exercises that can be used to combat metabolic diseases
- Exercises that are beneficial to the health of the lungs
- Heart disease prevention exercises that you can do at home
- An exercise program that will help you overcome physical inactivity and paralysis
Nutrition Research Topics Related to Sports
Student-athletes are always curious to learn how what they eat affects their Performance. These topics can be just as helpful to them as they are to medical students. Here’s your chance to write excellent nutritional research articles.
- Nutritional requirements for the provision of micronutrients and nutrients to the athlete of the body
- Essential polyunsaturated fatty acids for sportsmen
- Trans fatty acids and conjugated fatty acids for sportsmen
- Estimation of daily energy expenditure by athletes
- Estimation of the basal metabolic rate
- Calculation of the recommended daily energy intake
- Nutritional Needs of the General Population Compared to Athletes
- Evolution of carbohydrate recommendations
- Dietary Supplements to enhance athletic Performance
- The Role of Glycogen in Performance
- Interaction and synergy of metabolic pathways
- Energy and carbohydrates metabolism
- Comparison of sporting disciplines in terms of diet
- Consumption of food products intended for athletes
- Consumption of food supplements
- A healthy controlled diet and health benefits of sports nutrition
- Dietary supplements to improve circulation and health benefits
- Muscular development and fat mass loss
- Proteins, amino acids, and derivatives: Athletic support requirements
- Dietary supplements used by Athletes and their risks
- An athlete’s fight against fatigue.
- Athletes need vitamins
- Risks of post-exercise products
Food and Nutrition Research Topics
Understanding how different foods affect your health is a great reason to watch what you eat. The following topics can help you narrow your focus on the important aspects of food and nutrition that everyone should know about.
- The foods that contribute to negative thinking
- Chemical analysis of foods leads to negative thinking and fatigue.
- An economic analysis of food systems
- Health benefits of organic food vs. staple food
- The food security situation in the northern Saharan region
- An analysis of strategies that can be used to build resilience to food insecurity
- A food security perspective on the vegetable sector
- Evaluation of the food security situation in the country
- Insufficient nutrition among children is a significant problem.
- Urban Malnutrition and its Determinants in the developing world
- How public stock of food products Significantly impacts public health and safety.
- Households vulnerable to successive food shocks show a high level of resilience.
- Gardening for market income and ensuring the security of food and nutrition
- The profile and integrated management of severe acute malnutrition at the San Jose Hospital: a case study
- Unique health benefits of food additives for college students
- Nutritional contributions of keto diets
- Role of administrative authorities to assure food safety
- The nutritional and dietary behaviors of specific populations, as well as patients with specific conditions
- The determinants of eating innovative behavior
- Nutrition and health are interconnected through the mechanism of nutrient absorption.
Health and Nutrition Research Topics
We feel what we eat impacts our daily health and happiness. Some people want to change their diet but don’t know where to begin or how to avoid eating disorders. This list of hot topics will let you explore that.
- In terms of climate change and food security, what is the extent of the problem?
- Monitoring the nutritional status of the population utilizing various methods
- The promotion of nutrition research in the human population
- Importance of food safety in society
- The process of training teachers, trainers, and relay personnel.
- Training in the fields of medicine and paramedicine.
- Public health measures and actions that have been taken to improve public health
- Media and personality involvement in food and health issues at the level of artistic, cultural, and sports media and personalities
- How poor eating habits lead to food addiction and too many vitamins
- Establishing a system for evaluating the food provided to hospital patients
- An overview of nutrition-related illnesses and their diagnosis and treatment
- Initiatives aimed at educating patients on the importance of diet and health
- Tool to assess nutritional status as part of a clinical assessment
- How unbalanced diets and poor eating habits lead to poor nutrition
- Different food groups contribute to the immune system as healthier alternatives to poor feeding habits.
- Different food groups ensure healthy eating effects and prevent eating disorders.
- Ensure food safety with dietary guidelines with the help of food science.
Easy Nutrition Research Topics
If you want to avoid the complexities of research by choosing a simple topic, go with this list. Still, if you need help choosing a topic or writing a research paper, let our writers know. Here’s the list.
- Global food systems: A research paper on the subject
- The women’s perspective on breastfeeding and returning to work after maternity leave
- The effects of a balanced diet on the weight gain of pregnant women
- Health benefits of proper nutrition in women
- Consultation about diet during pregnancy and the delivery of twins.
- The importance of diet monitoring during pregnancy for women with gestational diabetes
- Managing diabetes in pregnant women and following up with them after delivery
- The impact of nutrition and micro-nutrition on the development of autoimmune diseases
- Analyzing the Effectiveness of artificial nutrition prescription practices in Adults
- The impact of a vegetarian diet on the development of a child
- Health benefits of nutrition education and promoting healthy food choices
- A guide for vegetarian pregnant women on how to take care of themselves
- The relationship between micronutrients and immunity
- Proper nutrition to overcome food additions and lose weight with homemade food
- The effect of lifestyle and dietary measures on patients with heart failure
- An examination of the relationship between oral health and nutrition in a population
- A study on the marketing of fruits and vegetables and healthy eating: characterization of the marketing channels involved
- How food science contributes to endorsing and promoting proper nutrition with the help of healthy organic foods
- A review of the association between orthostatic hypertension and geriatric syndromes
- The self-esteem of patients with liver transplants in terms of their physical appearance
- A report on the state of undernutrition in several hospitals on the island of Reunion
- Non-drug therapies in the management of pain in women: an overview of their use
- Insomnia management is based on a multidisciplinary approach.
- The Role of Communication in preventive actions in Pharmacies
For centuries, people have been fascinated with understanding how our bodies work and respond. That’s why there are so many interesting research topics on nutrition and nursing for today’s students to pick from. Speaking of which, we have put together 200 of the best nutrition topics for your research paper in this exciting blog post.
What are the 7 Areas of Nutrition?
The seven areas of nutrition are:
- Macronutrients
- Micronutrients
- Dietary Guidelines
- Nutritional assessment
What are five common nutritional concerns?
Five common nutritional concerns are:
- Inadequate Nutrient Intake
- Excessive Calorie Consumption
- Nutrient Deficiencies
- Unhealthy Eating Patterns
- Food Allergies or intolerances.
What are the three popular food-related topics for research?
Three popular food-related topics for research are:
- Sustainable Food Systems
- The Impact of Dietary Choices on Health and Disease Prevention
- The Development of Innovative Food Technologies to Address Food Security and Safety.
Order Original Papers & Essays
Your First Custom Paper Sample is on Us!
Timely Deliveries
No Plagiarism & AI
100% Refund
Try Our Free Paper Writing Service
Related blogs.
Connections with Writers and support
Privacy and Confidentiality Guarantee
Average Quality Score
Nutrition Research Topics: Top 185+ Ideas
Nutrition is a branch of science that studies the impact of different foods and drinks on our bodies and their association with diseases, health, and our diet. It examines how nutrients in food supply energy and the physiological and biochemical processes involved in nutrient absorption. We all comprehend the role nutrients play in our bodies and immune systems. It significantly decreases the risk of diseases and makes us more active and productive throughout our lives.
When you have to write about nutritional research topics, the information should be as accurate as possible. It implies that students must keep tabs on all the essential topics in nutrition, as well as topics that include integrated health and nutrition topics. Additionally, nutrition could be more complex than it might sound. However, if one knows the art of narrowing down some essential topics in food, the process can be much more straightforward for them. With our list of exciting nutrition topics for research papers, anyone can draft an excellent research paper. So, continue reading this blog that constitutes some brilliant research topics about nutrition.
Table of Contents
Choosing an Appropriate Nutrition Research Topic
We all understand the importance of the central topic for the entire research paper. Nutrition is a significantly broad field of study that entails topics regarding health education, health promotion, and human nutrition. Nutrients also include a branch of biochemistry, physical science, physiology, human anatomy, etc. Thus, selecting a research topic on your own is an uphill task because of these extensive research fields. However, if you exercise a few secret tips to choose your nutrient topics to research, the whole process will be more straightforward.
When choosing a nutrition research topic, consider the following:
- Relevance: Is the topic of interest to you relevant to current nutritional issues?
- Importance: Does the topic address a vital health or nutritional problem?
- Feasibility: Can the research be realistically completed with available resources and within the time frame?
- Uniqueness: Is the topic original, and has it yet to be extensively studied?
- Audience: Who is the intended audience for your research, and what is their level of interest in the topic?
185+ Nutrition Research Topics
Here is a list of some essential nutrition research topics you can use for your research. You can also refer to some nutrition capstone ideas if you need help deciding what topic to choose in your research. Nevertheless, here is a list of the best nutrition research topics you can use to start your research.
Nutritional Research Topics to Start Your Research
Understanding nutrition science is crucial for supporting one’s own health and survival. The research topics listed below help you articulate the significance of nutrition .
- Abdominal Fat and Health Risks (Abdominal Obesity)
- An overview of the trends and analysis of nutrients in foods
- Adolescence (including older children and teens)
- Adolescent and Childhood Obesity
- Aging (including older Americans)
- Blood Cholesterol Levels
- Biological and psychological aspects of eating disorders
- Body Mass Index (BMI): an overview
- Breast cancer and Smoking
- Bulimia: clinical features and long-term outcomes
- Breastfeeding an Infant with a Cow’s Milk Allergy
- Is becoming a vegan beneficial or harmful to society?
- influence of childhood obesity on the health and sanity of an individual
- Malnutrition’s effects on the immune system
- The impact of undernourishment on the mother and infant
- How a person’s behavior connects to their eating habits
- variations in how vitamins and minerals affect a person’s health.
- Nutritional and dietary factors that affect cardiac metabolism.
Research Topics on Essential Nutrients
There are three categories of nutrients named as- macro-nutrients, micro-nutrients, and water. An equal balance of these nutrients is essential for one’s health and survival. Below you will find some brilliant nutrition topics for research. You can explore each of the following topics to fully grasp and unravel your point of view regarding your selected topic.
- Exploring nutrition requirements for vulnerable groups
- Nutrition’s effect on how the body reacts to weight training
- The impact of ketogenic diets on cognitive and behavioral function
- Influence of amino acids on the human body
- Influence of early nutrients on man
- Effects of high dietary carbohydrates on fish nutrition
- Holick’s rule and vitamin D from sunlight
- Micro-nutrients for hair and nails
- Clinical effectiveness of standard components in oral hair growth supplements
- Nutrition and immunity
- The biological and functional consequences of zinc deficiency
- Exploring why anemia is still a significant health issue among women
- Different roles and biosynthesis of saturated and unsaturated fatty acids
- Exploring the adverse health effects of selenium on human health
- Diabetic complications and the imperativeness of glucose control for the human body
- Water as an essential nutrient: the physiological foundation of hydration
- Choline is an essential nutrient for humans.
- Understanding heavy metals as a critical nutrient for plants
Sports Nutrition Research Topics to Explore
Athletes are always curious to know more about the impact of nutrients on their performance. Whether you are a professional athlete or someone who works out regularly, an ideal diet filled with nutrients is essential. You require a suitable demand to replenish the energy the body drains while practicing. Consider exploring the following nutrition research topics about sports nutrition for your upcoming research paper:
- Eating problems are common among female athletes.
- Sports nutrition for the health and performance of athletes
- The significance of diversity in a sportsperson’s diet
- The effect of a plant-based diet on athletic performance
- The ideal amount of protein to consume for muscular growth
- The contribution of BCAAs to senior weightlifting performance
- The consumption of dietary supplements by athletes
- Muscle-enhancing behaviors among young athletes
- Plant-based protein vs. animal-based protein: an overview
- How do nutritional choices affect muscle recovery?
- Preserving electrolyte equilibrium throughout endurance training
- Creatine’s contribution to enhancing athletic performance
- Analyzing the contributions of protein and carbohydrates to athletes’ mental health
- Specialized diets that promote endurance and stamina
- A diet that beats fatigue replenishes energy and restores depleted stamina
- A thorough examination of post-workout nutrition for strength athletes
- Sports nutrition and performance: a detailed analysis
- The nutritional adequacy of plant-based diets
- Investigating how low-carb diet trends affect athletes’ performance
Research Topics in Nutrition Education
In simple terms, nutrition education is a sequential instructional program that educates an individual or group of individuals about the science of nutrients. Below are some exciting nutrition topics about education that will be useful for your research.
- Vegan and vegetarian diets
- How can nutrition benefit women’s and kids’ immune systems?
- Risk management mechanisms for food safety
- Preventing childhood obesity
- How water supports nutrient circulation and digestion
- The role of diets in illnesses like HIV/AIDS that already exist
- The contribution of nutrition to weight management
- The justification for those with chronic diseases needing particular dietary guidelines
- Dietary supplements: legend or reality?
- The safety of herbal supplements as dietary aids
- Reducing malnutrition by a balanced diet.
- Consumer behavior and nutrition education: a detailed analysis
- The effects of bad eating habits are elements that affect food safety.
- How can the world combat the obesity pandemic that is sweeping the globe?
- Children’s nutritional needs
- The role of nutrition in managing and gaining weight
Students can also correlate biology research topics from that with nutrition topics. These two subjects are associated with one another, which creates an essential option for students who need clarification on their topic.
Food and Nutrition Topics for Research Papers
Food and nutrition have an inextricable link that no one can break. All of us know a specific food item that contains lots of nutrients. Thus, we considered compiling a list of research topics based on food and nutrients. The following are some of the most promising food and nutrition research topics for students who want to dig deeper into this aspect.
- Why are sugars the main contributors to many health complications?
- Consumption of organic food for a healthy lifestyle
- The influence of intestinal health on dietary guidelines
- Exploring snacking habits for a healthy life
- Economical substitutes for wholesome organic meals
- effects of national food policy.
- The significance of fatty foods for the younger generation
- How chronic diseases impact nutritional health
- The function of macro- and micronutrients in maintaining general health
- The importance of carbohydrates in the human body
- Meat consumption and the risk of incident dementia
- Myths and facts about the food pyramid
- Relationship between food poisoning and food hygiene
- Chronic illnesses and wholesome food options
- The impact of protein on bone health
- Analyzing the effects of chocolate on human health
- Research the health advantages of indigestible substances.
Since nutritional food and substances play a significant part in a child’s development and growth, you can also consider reading our child development research topics . You can read the entire article and correlate both topics to develop a unique nutrition topic for a research paper.
Research Topics About Nutrition And Dietetics
Exploring more and more about food diets and their role in the growth and development of our bodies is always fascinating. If you are the one looking for research topics on nutrition and dietetics, then we have some of the best topics for you, all lined up in the below-given list:
- Exploring the risk factors associated with the ketogenic diet
- Dietary intake among US adults: 1999–2022.
- Is gluten as harmful to humans as the media portrays?
- A research analysis of herbal medicine for sports
- A thorough examination of yo-yo dieting
- Why should you avoid empty calories, and what are they?
- What impact has globalization had on our diet?
- Cholesterol-lowering effects of dietary fiber: a detailed analysis
- Nutritional modifications during the COVID-19 pandemic
- The justifications behind people’s dietary restrictions
- Omega 3 fatty acids
- Essential components of a nutritious diet?
- Eating habits versus exercise for good weight management
- Describe the advantages of breastfeeding for babies.
- Techniques for enhancing physical fitness while consuming fewer calories
- Herbal supplementation in the body: a detailed study
- Nutritional control of aging
- The role of nutrition in gerontology
Clinical Nutrition Topics for Research
Dear readers, these below given clinical nutrition topics for research might serve as your research paper help in your research. Explore each topic in the list below and select the topic that suits best your interest:
- Introduction to clinical nutrition and dietetics
- Recent advances in clinical nutrients
- COVID-19 and nutrition
- Dieticians’ Implicit Association Test for Fat People and Thin People to Assess Obesity Bias
- Drug and enzyme interactions in pharmacology
- Digestive system disorders
- An analysis of body composition measurements for health evaluation
- Review of Health Literacy and Nutrition Education’s Relationship
- Heart health and cardiovascular disorders
- Food- and nutrition-related myths and misunderstandings
- How micro-nutrients affect general health
- How macro-nutrients affect public health
- The impact of both passive and active lifestyles on overall health
- Skeletal Muscle Mass Ratio as a Measure of Sarcopenia in Type 2 Diabetic Patients
- A dietician’s perceived professionalism is unaffected by their appearance or white coat: a critical overview
- Body Composition Measured by Three Different Techniques Is Unaffected by a Small Food or Fluid Load
Health and Nutrition Research Paper Topics
Health and clinical research topics are extremely popular among students throughout the world. The experts at Edumagnate.com have cautiously gathered every topic in this below-provided list. If you are interested in studying more about this subject, we are sure these interesting nutrition topics for research papers would help you.
- The importance of healthy diets for treating mental health disorders
- Obesity prevention via smart food policies
- The pharmacological interaction between enzymes and medicines
- The importance of micro- and macro-nutrients in general health
- The most effective supplements for combat athletes’ bone and ligament health
- Investigate the health advantages of non-digestible substances.
- The significance of food for treating cognitive and brain power
- Binge eating in children and adolescents
- Is Weight Watchers a worthwhile program?
- Investigate the factors that contribute to weight gain in college students.
- How did the Paleo diet gain popularity?
- The effects of malnutrition.
- What is the yo-yo effect, and how does it function?
- Should we trust the “breakfast myth”?
- What is the cause of celiac disease?
- Why are Northern Europeans less likely than those from the Global South to be lactose intolerant?
- Chronic illnesses and good eating habits
- Why is sugar the leading cause of a wide range of health problems?
- Cost-effective alternatives to nutritious organic foods.
- The importance of diet in determining the body’s immunity
- The impact of chronic conditions on nutritional health
- The relevance of digestive health in dietary policy formulation
Research Topics in Nutrition Science
Depending on your interest, nutrition science can be both challenging and interesting. The central objective of nutrition science is to gather evidence that showcases how numerous eating behaviors impact human health. It entails studying different elements of food on chemical, biological, and physical levels. You can also consider reading our previous blogs on chemistry research topics and tweaking them according to your requirements. Nevertheless, let’s first dive deeper into the list of these enticing research topics in nutrition science.
- Exploring the science behind the dietary guidelines for female
- Filling the bridge between infantile brain development and food intake
- Is every calorie created equally?
- Microbiology’s function in food science
- A detailed study on the d ietary supplements
- Go over the advantages and disadvantages of enriched commercial bread.
- Examine the procedure for obtaining plant oil.
- Do nutrients vanish when something is heated up?
- Are GM crops harmful?
- Describe the distinction between fortifying and enriching.
- How does food science help older people consume better food?
- How are enzymes used in the food industry?
- What elements affect someone’s capacity to adhere to a certain diet?
- How is space food produced?
- National food policy: a detailed analysis
- The preventive features of individualized nutrition
- What effects does food have on your immune system?
- Describe the technologies that are employed to guarantee food safety.
- What is the influence of dietary factors on getting rid of cancer?
- A critical review of the history and future of food irradiation
Nutritional Research Topics for Eating Disorders
Consider reading about these nutrition research topics on eating disorders, and we’re sure you’ll like it:
- What is binge eating?
- Cardiovascular symptoms affect the patterns of habitual coffee consumption.
- Analyze the harmful stereotypes surrounding eating disorders.
- Causes of disordered eating habits
- Exploring childhood obesity in the 21st century
- Studies Linking Processed Meat, Unprocessed Red Meat, Poultry, or Fish Consumption to Cardiovascular Disease Incidence
- Why are female athletes at high risk for eating disorders?
- A critical analysis of food insecurity in the Bronx
- Risk factors associated with childhood obesity
- How can the government tackle obesity cases in rural areas?
- What are the various forms of treatment for eating disorders?
- Ways to prevent eating disorders in preteens
- Discuss the relationship between Smoking and weight.
- Understanding anorexia nervosa as an eating disorder
- Etiology of eating disorders
- The role of hunger in anorexia
- How do eating disorders affect one’s mental health?
- Exploring the impact of food insecurity among the youth
The Bottom Line
The nutrition research topics will help you systematically craft your entire research paper. You can choose any of the aforementioned topics and provide a unique angle that has never been explored. Before writing a research paper , narrow down a few relevant topics and research each. When you’ve researched those topics, you’ll have an idea of what topic you want to study, and once you’ve outlined your key points, you can move on to the writing process. Thus, consider reading the entire article so you don’t miss any essential topics.
By Alex Brown
I'm an ambitious, seasoned, and versatile author. I am experienced in proposing, outlining, and writing engaging assignments. Developing contagious academic work is always my top priority. I have a keen eye for detail and diligence in producing exceptional academic writing work. I work hard daily to help students with their assignments and projects. Experimenting with creative writing styles while maintaining a solid and informative voice is what I enjoy the most.
- Biochemistry and Molecular Biology
- Biostatistics
- Environmental Health and Engineering
- Epidemiology
- Health Policy and Management
- Health, Behavior and Society
- International Health
- Mental Health
- Molecular Microbiology and Immunology
- Population, Family and Reproductive Health
- Program Finder
- Admissions Services
- Course Directory
- Academic Calendar
- Hybrid Campus
- Lecture Series
- Convocation
- Strategy and Development
- Implementation and Impact
- Integrity and Oversight
- In the School
- In the Field
- In Baltimore
- Resources for Practitioners
- Articles & News Releases
- In The News
- Statements & Announcements
- At a Glance
- Student Life
- Strategic Priorities
- Inclusion, Diversity, Anti-Racism, and Equity (IDARE)
- What is Public Health?
- Recent Dissertation Titles
- MSPH Field Placements
- Master's Essays
- MAS Application Fee Waiver Requirements
- Master of Arts and Master of Science in Public Health (MA/MSPH)
- Master of Arts in Public Health Biology (MAPHB)
- Master of Bioethics (MBE)
- Mission, Vision, and Values
- Student Experience
- Program Outcomes
- For Hopkins Undergraduate Students
- Master of Health Science (MHS) - Department of Biochemistry and Molecular Biology
- Master of Health Science (MHS) - Department of Epidemiology
- Alumni Update
- MHS Combined with a Certificate Program
- Master of Health Science (MHS) - Department of Molecular Microbiology and Immunology
- Bachelor's/MHS in Health Economics and Outcomes Research
- MHS HEOR Careers
- Frequently Asked Questions
- Master of Health Science (MHS)
- Concurrent School-Wide Master of Health Science Program in Biostatistics
- Master of Health Science - Department of Population, Family and Reproductive Health
- Master of Health Science Online (MHS) - Department of Population, Family and Reproductive Health
- Careers in Health Economics
- Core Competencies
- Meet the Director
- What is Health Economics
- MPH Capstone Schedule
- Concentrations
- Online/Part-Time Format
- Requirements
- Tuition and Funding
- Executive Board Faculty
- Master of Science (ScM) - Department of Biochemistry and Molecular Biology
- Master of Science (ScM) - Department of Biostatistics
- Master of Science (ScM) - Department of Epidemiology
- Master of Science (ScM) - Department of Molecular Microbiology and Immunology
- Bachelor's/MSPH in Health Policy
- FAQ for MSPH in Health Policy
- Field Placement Experience
- MSPH Capstone
- MSPH Practicum
- Required and Elective Courses
- Student Timeline
- Career Opportunities
- 38-Week Dietetics Practicum
- Completion Requirements
- MSPH/RD Program FAQ
- Program Goals
- Application Fee Waiver Requirements
- Doctor of Philosophy (PhD) - Department of Biostatistics
- Doctor of Philosophy (PhD) - Department of Epidemiology
- Program Goals and Expectations
- Doctor of Philosophy (PhD) - Department of Molecular Microbiology and Immunology
- Doctor of Philosophy (PhD) - Department of Population, Family and Reproductive Health
- Doctor of Philosophy (PhD) in Clinical Investigation
- Recent Graduates and Dissertation Titles
- PhD Funding
- PhD TA Requirement
- JHU-Tsinghua Doctor of Public Health
- Prerequisites
- Concentration in Women’s and Reproductive Health
- Custom Track
- Concentration in Environmental Health
- Concentration in Global Health: Policy and Evaluation
- Concentration in Health Equity and Social Justice
- Concentration in Health Policy and Management
- Concentration in Implementation Science
- Combined Bachelor's / Master's Programs
- Concurrent MHS Option for BSPH Doctoral Students
- Concurrent MSPH Option for JHSPH Doctoral students
- Doctor of Medicine and Doctor of Philosophy (MD/PhD)
- Adolescent Health Certificate Program
- Bioethics Certificate Program
- Clinical Trials Certificate Program
- Community- Based Public Health Certificate Program
- Demographic Methods Certificate Program
- Epidemiology for Public Health Professionals Certificate Program
- Evaluation: International Health Programs Certificate Program
- Frequently Asked Questions for Certificate Programs
- Gender and Health Certificate Program
- Gerontology Certificate Program
- Global Digital Health Certificate Program
- Global Health Certificate Program
- Global Health Practice Certificate Program
- Health Communication Certificate Program
- Health Disparities and Health Inequality Certificate Program
- Health Education Certificate Program
- Health Finance and Management Certificate Program
- Health and Human Rights Certificate Program
- Healthcare Epidemiology and Infection Prevention and Control Certificate Program
- Humanitarian Health Certificate Program
- Implementation Science and Research Practice Certificate Program
- Injury and Violence Prevention Certificate Program
- International Healthcare Management and Leadership Certificate Program
- Leadership for Public Health and Healthcare Certificate Program
- Lesbian, Gay, Bisexual, Transgender, and Queer (LGBTQ) Public Health Certificate Program
- Maternal and Child Health Certificate Program
- Mental Health Policy, Economics and Services Certificate Program
- Non-Degree Students General Admissions Info
- Pharmacoepidemiology and Drug Safety Certificate Program
- Population Health Management Certificate Program
- Population and Health Certificate Program
- Public Health Advocacy Certificate Program
- Public Health Economics Certificate Program
- Public Health Informatics Certificate Program
- Public Health Practice Certificate Program
- Public Health Training Certificate for American Indian Health Professionals
- Public Mental Health Research Certificate Program
- Quality, Patient Safety and Outcomes Research Certificate Program
- Quantitative Methods in Public Health Certificate Program
- Requirements for Successful Completion of a Certificate Program
- Rigor, Reproducibility, and Responsibility in Scientific Practice Certificate Program
- Risk Sciences and Public Policy Certificate Program
- Spatial Analysis for Public Health Certificate Program
- Training Certificate in Public Health
- Tropical Medicine Certificate Program
- Tuition for Certificate Programs
- Vaccine Science and Policy Certificate Program
- Online Student Experience
- MAS and Affiliated Certificate Programs
- Barcelona Information
- Registration, Tuition, and Fees
- Agency Scholarship Application
- General Scholarship Application
- UPF Scholarship Application
- Course Evaluations
- Online Courses
- Registration
- General Institute Tuition Information
- International Students
- Directions to the Bloomberg School
- All Courses
- Important Guidance for ONSITE Students
- D.C. Courses
- Registration and Fees
- Cancellation and Closure Policies
- Application Procedures
- Career Search
- Current Activities
- Current Trainees
- Related Links
- Process for Appointing Postdoctoral Fellows
- Message from the Director
- Program Details
- Admissions FAQ
- Current Residents
- Elective Opportunities for Visiting Trainees
- What is Occupational and Environmental Medicine?
- Admissions Info
- Graduates by Year
- Compensation and Benefits
- How to Apply
- Academic Committee
- Course Details and Registration
- Tuition and Fees
- ONLINE SOCI PROGRAM
- Principal Faculty
- General Application
- JHHS Application
- Our Faculty
- Descripción los Cursos
- Programa en Epidemiología para Gestores de Salud, Basado en Internet
- Consultants
- Britt Dahlberg, PhD
- Joke Bradt, PhD, MT-BC
- Mark R. Luborsky, PhD
- Marsha Wittink, PhD
- Rebekka Lee, ScD
- Su Yeon Lee-Tauler, PhD
- Theresa Hoeft, PhD
- Vicki L. Plano Clark, PhD
- Program Retreat
- Mixed Methods Applications: Illustrations
- Announcements
- 2023 Call for Applications
- Jennifer I Manuel, PhD, MSW
- Joke Bradt, PhD
- Josiemer Mattei, PhD, MPH
- Justin Sanders, MD, MSc
- Linda Charmaran, PhD
- Nao Hagiwara, PhD
- Nynikka R. A. Palmer, DrPH, MPH
- Olayinka O. Shiyanbola, BPharm, PhD
- Sarah Ronis, MD, MPH
- Susan D. Brown, PhD
- Tara Lagu, MD, MPH
- Theresa Hoft, PhD
- Wynne E. Norton, PhD
- Yvonne Mensa-Wilmot, PhD, MPH
- A. Susana Ramírez, PhD, MPH
- Animesh Sabnis, MD, MSHS
- Autumn Kieber-Emmons, MD, MPH
- Benjamin Han, MD, MPH
- Brooke A. Levandowski, PhD, MPA
- Camille R. Quinn, PhD, AM, LCSW
- Justine Wu, MD, MPH
- Kelly Aschbrenner, PhD
- Kim N. Danforth, ScD, MPH
- Loreto Leiva, PhD
- Marie Brault, PhD
- Mary E. Cooley, PhD, RN, FAAN
- Meganne K. Masko, PhD, MT-BC/L
- PhuongThao D. Le, PhD, MPH
- Rebecca Lobb, ScD, MPH
- Allegra R. Gordon, ScD MPH
- Anita Misra-Hebert, MD MPH FACP
- Arden M. Morris, MD, MPH
- Caroline Silva, PhD
- Danielle Davidov, PhD
- Hans Oh, PhD
- J. Nicholas Dionne-Odom, PhD RN ACHPN
- Jacqueline Mogle, PhD
- Jammie Hopkins, DrPH, MS
- Joe Glass, PhD MSW
- Karen Whiteman, PhD MSW
- Katie Schultz, PhD MSW
- Rose Molina, MD
- Uriyoán Colón-Ramos, ScD MPA
- Andrew Riley, PhD
- Byron J. Powell, PhD, LCSW
- Carrie Nieman MD, MPH
- Charles R. Rogers, PhD, MPH, MS, CHES®
- Emily E. Haroz, PhD
- Jennifer Tsui, Ph.D., M.P.H.
- Jessica Magidson, PhD
- Katherine Sanchez, PhD, LCSW
- Kelly Doran, MD, MHS
- Kiara Alvarez, PhD
- LaPrincess C. Brewer, MD, MPH
- Melissa Radey, PhD, MA, MSSW
- Sophia L. Johnson, PharmD, MPH, PhD
- Supriya Gupta Mohile, MD, MS
- Virginia McKay, PhD
- Andrew Cohen, MD, PhD
- Angela Chen, PhD, PMHNP-BC, RN
- Christopher Salas-Wright, PhD, MSW
- Eliza Park MD, MS
- Jaime M. Hughes, PhD, MPH, MSW
- Johanne Eliacin, PhD, HSPP
- Lingrui Liu ScD MS
- Meaghan Kennedy, MD
- Nicole Stadnick, PhD, MPH
- Paula Aristizabal, MD
- Radhika Sundararajan, MD
- Sara Mamo, AuD, PhD
- Tullika Garg, MD MPH FACS
- Allison Magnuson, DO
- Ariel Williamson PhD, DBSM
- Benita Bamgbade, PharmD, PhD
- Christopher Woodrell MD
- Hung-Jui (Ray) Tan, MD, MSHPM
- Jasmine Abrams, PhD
- Jose Alejandro Rauh-Hain, MD
- Karen Flórez, DrPH, MPH
- Lavanya Vasudevan, PhD, MPH, CPH
- Maria Garcia, MD, MPH
- Robert Brady, PhD
- Saria Hassan, MD
- Scherezade Mama, DrPH
- Yuan Lu, ScD
- 2021 Scholars
- Sign Up for Our Email List
- Workforce Training
- Cells-to-Society Courses
- Course/Section Numbers Explained
- Pathway Program with Goucher College
- The George G. Graham Lecture
Environmental enteric dysfunction in early childhood: bridging the gap between diet and stunting in randomized trial of complementary food supplementation in rural Bangladesh (2016).
Evaluation of a pricing and communications intervention with food wholesalers and small food stores to improve supply and demand of healthier foods in Baltimore City (2016).
The role of social relationships in diet and diet-related health outcomes among urban low-income African American adolescents in Baltimore City (2015).
The child plasma proteome: Discovering its application in public health (2015).
Dietary intake, environmental tobacco smoke, nutrient biomarkers and chronic disease risk in United States adolescents (2015).
Effectiveness of a community based participatory program to improve child nutritional status in eastern rural Ethiopia: a cluster randomized trial (2015).
Early life programming of cardiometabolic disease: the role of prenatal zinc, intrauterine growth and the development of the fetal autonomic system (2015).
Formula use in a breastfeeding culture: changing perceptions and patterns of young infant feeding in Vietnam (2015).
Evaluating eating patterns of toddlers from low-income households: a multi-method approach to understanding eating behaviors in young children (2014).
Understanding the processes and challenges of community implementation of a food store based intervention on the Navajo Nation (2014).
- Write my thesis
- Thesis writers
- Buy thesis papers
- Bachelor thesis
- Master's thesis
- Thesis editing services
- Thesis proofreading services
- Buy a thesis online
- Write my dissertation
- Dissertation proposal help
- Pay for dissertation
- Custom dissertation
- Dissertation help online
- Buy dissertation online
- Cheap dissertation
- Dissertation editing services
- Write my research paper
- Buy research paper online
- Pay for research paper
- Research paper help
- Order research paper
- Custom research paper
- Cheap research paper
- Research papers for sale
- Thesis subjects
- How It Works
50 Best Nutrition Research Topics to Write About
One of the first hurdles that students face when conducting a research project is coming up with a list of topics in nutrition that are original, interesting, and manageable. This list of 50 nutrition paper topics was compiled by our writing experts and is perfect for a variety of assignment types.
Nutrition Research Topics for Junior High School
This collection of nutrition essay topics is great for short junior high school projects. They challenge students to conduct research without being too much to handle:
- Are our junior high and high school students getting enough protein from school cafeteria meals?
- How much does poor nutrition lead to high obesity levels for children from lower-income families?
- How important are vitamins to the proper development of children aged 12 and younger?
- What are some of the habits of healthy eating that junior high schools need to develop to pave the way for nutrition improvement?
- What is the nutritional value of foods that are considered to be traditional in the United States?
Current Topics in Nutrition for High School
Five current nutrition topics ideal for students in high school taking health courses or looking to pursue a career in nutrition:
- Why is it important for people to know their individual health histories to eat healthily?
- Does a current shift in healthy eating lead to long-term positive effects?
- If you were allowed to create your healthy nutrition program, what would it include?
- Do students consume the appropriate level of water per day or are they falling below healthy levels?
- Are child obesity rates higher in the U.S. than in other parts of the world?
Nutrition Topics for Research at the College Level
These nutrition research topics for college students pursuing a post-graduate career in health and nutrition:
- Does healthy eating affect your mood in positive ways or do you feel the same?
- Considering all the healthy options that exist in first-world countries, why don’t people adopt a healthy lifestyle?
- In what ways does a parent’s nutritional lifestyle affect the way his or her kid(s) lifestyle?
- Do you think it is possible to transition from a meat-protein-based diet to a vegan-protein-based one?
- How often should college students indulge in treats as a form of reward for hard work?
Hot Topics in Nutrition and Healthy Dieting
Five nutrition hot topics that will inspire you to conduct a great research project on healthy dieting and living through proper nutrition:
- How many meals should a person eat per day to achieve optimal health?
- What evidence exists to back-up claims that healthy eating affects overall wellness in adults?
- How does healthy eating impact a professional athlete’s ability to perform in his or her profession?
- How does the U.S. nutritional diet compare to that of other first-world countries?
- Is it really important for people to hydrate with water versus sports drinks?
Nutrition Topics to Write About
Need nutrition topics for presentation? We’ve got you covered with these 5 great ideas that are sure to impress any audience:
- Nutrition versus exercise: which strategy is better for optimum health?
- How does a person increase the level of exercise when they are on a diet and getting fewer calories?
- In a self-evaluation, do you feel you meet the standards of a healthy nutritional lifestyle?
- How important is nutrient to overall wellness in adults over 40 years old?
- Do you feel you have the option to select healthy or unhealthy foods each day?
Highly Controversial Topics in Nutrition
The following controversial nutrition topics can be used at both the high school and college levels and can be applied for short or long writing projects:
- How dangerous are diets that are high in sugar compared to other diets that are low in sugar content?
- Are infants at greater risk of becoming obese when consuming certain brands of infant formulas?
- What is the biggest reason that fast food restaurants do not add healthier meal options for patrons?
- How dangerous is binge eating and how does it lead to long-term health problems?
- Is coffee bad for your health?
Top Trending Nutrition Topics for 2022
This is a list of the top 5 trending topics on the subject of nutrition for 2022. Use them as-is or modify them to fit your interests:
- What do patients who have been diagnosed with Gout or other types of arthritis have to deal with nutritionally to stay healthy and reduce the number of painful flare-ups per year?
- When it comes to properties that can fight cancer, which foods have been scientifically proven to be the best?
- Women’s health is greatly affected by the foods they eat throughout their lives. Which foods are the most dangerous?
- Why should children aged 2 – 5 eat healthier to promote a long-term lifestyle of health?
- Are carbohydrate deprivation diets effective ways for teenagers to lose weight?
Excellent Sports Nutrition Topics
These hot nutrition topics have been highly debated in the sports world in the past year and are relevant for 2020 as more research and evidence come to light:
- Should parents take a more active role in their children’s athletic diets at school?
- Should college universities take more effective steps toward introducing healthy diets for their student-athletes?
- Are vegans and vegetarian athletes at greater risk of developing health problems?
- Should athletes try to avoid fats (including healthy fats) to cut weight?
- How effective is the “moderation” diet in keeping athletes at competitive health levels?
Topics in Clinical Nutrition
These nutrition topics for college students are ideal for research papers of 10 or more pages and are sure to garner much attention from even the toughest professors:
- What research is there to support the belief that aggressive and argumentative behavior can be influenced by poor nutrition?
- Are vitamins and supplements adequate at replacing important nutrients from a healthy diet?
- Do people eat enough vitamins known to be essential to a healthy lifestyle?
- Should all fast-food restaurants be held to the recommended standards of a healthy diet in the U.S.?
- How many times per month should people eat alternative or unnatural foods?
Popular Nutrition Topics
The following interesting nutrition topics are great for short papers (about 5 – 8 pages max) and require just a few hours of research time at your local and school libraries:
- Should the United States take a proactive approach in rationing foods it considers unhealthy?
- What are the most common ingredients in foods that have the greatest health risk for people?
- Do you think it would be wise to limit advertisements from companies that sell unhealthy meals?
- Should restaurants be required to provide detailed nutritional information on all their menu items?
- If people were educated on the actual nutritional value of common food items, would they choose to eat healthier?
For more nutrition-related topics contact our medical thesis writers who can customize a list of nutrition research paper topics to suit your assignment needs. Give us a call, email, or chat with us today to get your nutrition topics within a few hours.
Leave a Reply Cancel reply
Enjoy a completely custom, expertly-written dissertation. Choose from hundreds of writers, all of whom are career specialists in your subject.
Top Nutrition Research Topics
Nutrition is an essential aspect of our lives as human beings. Its importance is one of the reasons why we must discuss topics relating to nutrition. Being aware of what we consume and why we consume them help us become aware of our health and make us conscious of what we take in. These topics span different branches, applications, and fields to ensure that we pass the correct information.
Nutrition topics are a broad range of topics that do not only talk about food. What you eat is a major determining factor to a lot about you, and hence should be reflected in your choice of topics. These topics cover what you eat and how it affects your health, your career, and even down to your mood. With new dieting and nutritional patterns introduced daily, environment and other factors affecting food as we know it, people want to understand it all.
A lot is changing, and nutrition isn’t left out in this change, hence the need to discuss these nutrition-related topics. These topics help throw light on these changes to get in-depth knowledge to ensure you’re not harming yourself. These articles will provide you with these nutritional research topics. Furthermore, if you’re yet to choose from nutrition topics to research, we will provide you with a guide on how to do so. Keep reading.
How to Come up with Nutrition Topics to Write About
Choosing topics for any form of writing is as essential as the entire piece of writing. Food research topics aim to pass a message, share an idea, or educate. The aim of your paper should be reflected in your choice of subject so the message is passed immediately and efficiently.
While choosing the right topic is essential, you should also pay attention to your work to do it right. You can always outsource your writing pieces to an expert to ensure it is done right. Here are some tips on how to come up with your own topics.
- What would your audience want to know You can choose a topic by putting yourself in your audience’s shoes. Whether throwing more light on an already existing fact or explaining something new would be helpful to your audience. Proper research would help you decide what areas fall under this category and what to write about. Ensure you include facts and relevant information. Choosing a topic people want to read about gives you an extra edge and places you in a place of authority.
- Ensure your topic is definite Finding research topics about food can be broad, so you should be definite. Try choosing a topic that isn’t too narrow and, at the same time, isn’t too much to cover either. Instead of selecting a topic you may not be able to cover effectively. It is better to choose a slight angle you can cover in-depth. This will help make your job easier and let your readers understand your point without a hassle.
- Choose a nutrition topic you’re interested about It is always easier to work on a topic you’re interested in. Your interest can stem from curiosity, zeal to prove a point, or wanting to find out more about a topic of interest. Whatever your reason, it makes the process of gathering facts a lot easier and faster. Depending on your chosen topic, you may already have some background knowledge of what you want to write about.
Research Topics on Nutrition
- Various weight loss approaches, which is healthy and which isn’t?
- Tracking calorie content in foods and why you should do it.
- Why are there so many available diet choices? Are they all healthy?
- Food allergies; why does the body react to certain foods?
- Is overhydration possible?
- Which is easier to handle, obesity or anorexia?
- Has food processing done more harm than good? Discuss with case studies.
- Mineral deficiency in infants and how to correct it.
- Healthy developmental food for infants.
- Influence of cultural background on nutritional habits.
Nutrition Topics for Research on Vegetarianism
- Does vegetarianism lead to any form of nutrient disorder?
- Pescetarian, veganism, fruitarian, etc., why the sudden awareness?
- What are the environmental implications of vegetarianism?
- Should vegetarian meals be introduced to cafeteria menus in schools?
- Positive effects of vegetarianism.
- Should we all be vegetarians? Discuss
- Are pure vegetarian diets suitable for all ages?
- Does vegetarianism provide you with all the necessary nutrients?
- Adopting vegetarianism as a beginner. All you need to know.
- Vegetarian nutrition. Eating the healthy way.
Nutrition Science Topics
- Chemical components of food ingredients (choose at least three case studies)
- The high rise of caffeine addiction among middle-aged white-collar professionals.
- Alcohol consumption and its effect on nutritional health.
- How social media influences the younger generation’s food choices and nutritional habits.
- What are the major influencing factors of food disorders? Genetics or lifestyle choices.
- Are national food policies necessary?
- Are there safe food processing measures? What are the regulating bodies?
- Your immune system and what you eat. How to be on the safe side.
- Food poisoning. What factors make everyday food become poisonous?
- Genetically engineered plants. Has science gone too far?
Nutrition Topics for College Students
- Nutritional habits among young adults and what influences them.
- Government nutritional policies and measures to ensure it is being adopted.
- Why is breakfast said to be the day’s most important meal?
- Should the government have a say in what you eat as an individual?
- Common nutritional habits among college students. Which is healthy and which isn’t?
- In-depth analysis of various dieting systems. What are their pros and cons?
- Healthy eating as a method of stress relief.
- Brain foods you didn’t know about and why you need them.
- Is food security possible? What are active measures?
- Is dieting expensive, and are there other pocket-friendly options?
Controversial Nutrition Topics
- Dieting and taking it to the extreme among young adults.
- Psychological approach to treating eating disorders
- Nutritional deficiencies associated with dieting for weight loss.
- Mineral deficiency and overdose, how do you handle both situations?
- Complete proteins and their makeup.
- Why lactose intolerance is a common nutritional health deficiency.
- Vitamins and food supplements. When do they become indispensable?
- What are the effects of cholesterol on human health?
- Metabolic processes involve different food types and why you should know them.
- Nutritional benefits of various foods, myths, and facts.
Sports Nutrition Topics for Research
- Exercising and dieting for weight loss and striking a balance.
- Dieting as a professional athlete is all you need to know.
- Do healthy nutritional habits replace exercising completely?
- Nutritional do’s and don’ts to maintain a healthy athletic career.
- Common eating disorders among athletes and why.
- Are supplements a healthy choice for athletes?
- Caffeine addiction among young adults, especially athletes.
- Bodybuilding diets for athletes. Doing nutrition the right way.
- Creatine and athletics. Why is it of any importance?
- When you eat versus what you eat. Are they of equal importance?
Health and Nutrition Topics
- Does introducing technology to farm methods affect the quality of food produced?
- All you need to know is the tobacco industry then and now.
- Food production as a global industry, how does it affect world poverty?
- The alarming rate of fast food consumption and how it affects your general health.
- Dietary requirements across various illnesses. Are they effective?
- Eating your way to sound health is the ultimate guide.
- Essential nutrition for infant development across different stages.
- Why is fast food still consumed despite how harmful it is being common knowledge?
- Why certain foods are risk factors for illnesses.
- How does malnutrition reflect amongst adults?
Nutrition Topics on Eating Disorders
- Self-awareness among young adults and how it influences nutritional patterns.
- Eating disorders. Types, symptoms, effects, preventive and treatment methods.
- Discuss the environment as a contributing factor to eating disorders.
- Eating disorder stereotypes. Myths and facts.
- Are eating disorders gender specific? Which gender is more prone?
- Discuss intermittent fasting as a trigger to developing an eating disorder.
- Eating disorders are associated with stress and how to treat it.
- The influence of social media on handling eating disorders.
- Psychological implications of eating disorders and how it affects other aspects of your life.
- Characteristics of eating disorders that are easily misdiagnosed.
Popular Nutrition Topics
- How do parents’ nutritional habits rub off on children?
- The effect of age in changing diets and why it is essential.
- Sleep and nutrition as healthy companions. Why are they both necessary?
- Does nutrition affect your mood and mental health in general? Discuss
- Social media and food choices.
- The influence of marketing on nutrition. How marketing presents everything as good.
- Can supplements replace the original nutrient-providing food?
- Long-term effect of dieting on the human body.
- What weight is overweight?
- Sugar intake at various age levels. When is it advisable?
Interesting Nutrition Topics
- The habit of stress eating and how it affects your productivity
- Your eating habits and your hormones, what is the relationship?
- Food preparation and its role in nutrient retention of different foods.
- Nutrition in infants; do’s and don’ts.
- Planning a personal food menu, what should be there and what shouldn’t.
- Vegetables and herbal supplements, are they the same?
- Curating a balanced diet and its current cost implication.
- Dehydration is a significant concern in infant nutrition.
- Food processing, its advantages, and disadvantages.
- Effect of food choices on diabetic patients.
Writing can be tricky, but it is easier if you don’t have to figure it out alone. This article is provided to serve as a guide to help provide you with insights on how to go about it. All the topics are original topics you can easily pick from. If you’re still looking for something different, you can paraphrase our topics however you want or follow the guide to come up with yours.
Frequently Asked Questions
Richard Ginger is a dissertation writer and freelance columnist with a wealth of knowledge and expertise in the writing industry. He handles every project he works on with precision while keeping attention to details and ensuring that every work he does is unique.
Succeed With A Perfect Dissertation
Leave a Reply Cancel reply
Your email address will not be published. Required fields are marked *
Save my name, email, and website in this browser for the next time I comment.
As Putin continues killing civilians, bombing kindergartens, and threatening WWIII, Ukraine fights for the world's peaceful future.
Ukraine Live Updates
Custom Essay, Term Paper & Research paper writing services
- testimonials
Toll Free: +1 (888) 354-4744
Email: [email protected]
Writing custom essays & research papers since 2008
191 nutrition research topics for your paper.
Is your course on food and nutrition giving you sleepless nights? Are you finding it tedious to come up with nutrition topics for your paper? Well, we have all the answers you need plus more! With years of expertise in academic writing , our trusted writers have all it takes to give you top grades. Keep reading with a hawk eye!
What Is Nutrition?
Nutrition deals with studying nutrients in food, their relationship with health, diet, and disease. It also delves into how the body uses nutrients for different functions.
Every day, our bodies indulge in various activities. For instance, you are here reading this blog – that is work by itself! For the body to perform all these functions effectively, it needs energy! Are our bodies like cars that are fueled now and then? No! Our bodies need food to produce the energy necessary for repair, growth, and other vital processes.
How To Write Nutrition Papers
The beauty of nutrition is that it touches on what we do every day. That is why writing such papers is not as complicated as most college and university students perceive it to be. However, here are some tips to give you a head start:
Identify the type of nutrition you are dealing with (either autotrophic or heterotrophic mode) Beware of the crucial concepts of nutrition, such as absorption, conversion, and reduction. Understand the essence of nutrition to living organisms Differentiate between nutrition in plants and animals Know about the various enzymes and hormones involved in nutrition.
With all these at hand, you can finish your nutrition paper in no time!
We have identified a list of hot nutrition topics to help you save time and beat your deadline. Use them as an inspiration for your nutrition paper today. All the best!
Quality Nutrition Research Topics
- The essence of nutrition in leading a healthy life
- How a balanced diet helps to lower the risks of diseases in an organism
- The process of energy production to the cells from food nutrients
- The role of water, carbon dioxide, and sunlight in the process of photosynthesis in plants
- Compare and contrast the feeding behaviors of heterotrophs and autotrophs
- What are the distinguishing characteristics of mixotrophs?
- Discuss what goes on during ingestion, digestion, absorption, and assimilation of solid food material in the body of an animal
- How animals convert complex food substances into simpler substances
- How long can organisms stay without food and water?
- The role of environment and adaptions in determining the mode of nutrition of an organism
- Discuss the process of synthesizing proteins into other essential compounds
The Best Nutrition Topics For College Students
- How does the body produce amino acids and absorb others from food?
- The role of the blood in carrying nutrients throughout the body
- Explain why glucose is the main source of energy for the body
- Sources of calories: A case study of fats and proteins
- Describe how the digestive system of a human body converts carbohydrates to glucose
- How do cells, tissues, and organs absorb nutrients from food?
- Why high levels of cholesterol in the body may lead to heart diseases
- The impact of diarrhea, sweating, vomiting and urinating on the loss of body liquids
- What is the role of dietary supplements in the body?
- How the body uses electrolytes in the place of limited fluids
Current Nutrition Topics
- How does the body use fatty acids for energy and tissue development?
- Compare and contrast between soluble and insoluble fibers
- How to make yourself feel full faster and stay full for a longer time
- The role of nutrition in reducing body weight and obesity
- How diets expose different people to cancer
- Discuss the biochemical and physiological processes involved in nourishment
- The role of food in the development of chronic diseases in humans
- The impact of depression and anxiety on nutrition
- The role of nutritional knowledge in making informed decisions about what you eat
- How to modify a diet so that you can combat a disease
Nutrition Hot Topics On Fats
- How do fats help in the lubrication of body joints?
- The role of fats in producing hormones in various body organs
- Why are fats necessary for the absorption of vitamins in the body?
- How to reduce inflammation through regulated intake of fats in the body
- The role of fats in helping to preserve brain health in humans
- How does too much fat lead to obesity?
- Why different fats have varying effects on a person’s health
- The role of unsaturated fats in the body
- Compare and contrast the effects of fats from animals and those from plants
- The impact of fats in causing high cholesterol levels and liver diseases
Popular Nutrition Topics
- Why most plant-based foods have limited amounts of proteins
- What is the implication of taking a vegan diet for a long?
- Why is it hard for the body to break down and absorb some of the complex carbs?
- The role of fibers in reducing the risk of contracting diabetes and cardiovascular disease
- Why taking sugars can cause diabetes.
- How do nutritionists use ideas from molecular biology in their operations?
- The impact of nutrients to the human body: A case of genetics
- What causes food allergies among people with different health conditions?
- Discuss the process of metabolizing fiber by the gut bacteria
- What makes the adult human body contain up to 60% of water?
Impressive Nutrition Topics For Presentation
- The role of the media in advising people on what to eat and not to eat
- The implication of the growing number of celebrity chefs and fine dining advertisements to nutrition
- How food affects your short term and long term health
- Using knowledge in food and nutrition to improve the skin condition
- How does the food one takes impact his/her sleeping habits?
- Discuss the rate of water intake depending on one’s size, level of activity, and weather
- What determines whether an animal feeds on simple or complex inorganic compounds?
- Why taking sugary foods can lead to loss of memory and inactivity
- The impact of fast-food restaurants on lifestyle diseases such as cancer
- Why taking too many snack foods is not good for your health
Nutrition Topics For College Students
- The role of vitamins and minerals in the proper functioning of the body
- Why is it recommended to take regulated amounts of vitamins?
- The process of converting food nutrients into minerals
- How do different sugars affect the functioning of the body?
- What is the implication of dehydration to the body cells and organelles?
- Nutritional factors that affect the proper functioning of body receptor cells
- Why the human body cannot do without glucose
- When should one use supplements for any nutrient?
- The development of ketosis disease as a result of improper nutrition
- Why are vitamins and minerals more soluble than other food nutrients?
Developing Nutrition Topics For Research
- The role of the WHO and FAO in determining proper nutrition
- The role of sunlight in supplementing food nutrients necessary for body functions
- What is the essence of proper nutrition in combating coronavirus disease?
- Explain why pregnant women crave different foods
- How different cuisines vary in their determination of a balanced diet
- How does the skin absorb Vitamin D from sunlight and use it in the body?
- How often should one take water during the winter seasons?
- The impact of taking alcohol during pregnancy in women
- Why do numerous women suffer from anemia?
- What influences the presence of minerals in food?
Sports Nutrition Topics
- The role of good nutrition in maintaining an excellent athletics record
- Why energy management is important for muscle and brain development
- Why drinking water before, during, and after exercise is healthy for sportsmen
- The role of a high carbohydrate meal for an athlete
- Evaluate the various nutrients necessary after finishing a hard workout or activity
- How athletes can manage hunger and satiety cues
- The role of sports drinks during prolonged training sessions
- How advertisers use bright colors and jazzy packaging to remind athletes to drink more fluids during exercise
- The role of healthy meat alternatives such as beans and lentils for athletes who are vegans
- The role of calcium and vitamin D to sportsmen and women
Nutrition Education Topics
- Why displaying the calorie content on menus affects consumer satisfaction
- Reasons why it is not advisable to take too much chili
- How the world can best deal with the global epidemic of obesity
- Why adolescents are fond of consuming sugar-sweetened beverages
- Restaurant standards that can help reduce obesity among US citizens
- How school district nutrition policies can help curb overweight among students
- The risk of anemia and obesity among children aged 2-18 years old
- Is eating an automatic behavior that humans find difficult to self-regulate?
- The role of nutrition education in shaping the food environment
- Discuss the economic, social, and environmental effects of poor nutrition
Health And Nutrition Topics
- How to develop sustainable nutrition policies in the wake of technology
- Why countries need to take a proactive approach to health and nutrition
- The role of nutrition in determining the immunity of the body
- Why plants a gold mine in preventing and treating diseases
- The impact of mood and mental wellness on a healthy living
- Why transparency is important building trust among doctors and patients
- Why healthy aging is important for active aging
- The role of digestive health in determining nutrition policies
- The part of proteins in sustainability and health
- Why sugars are the major causes of various health complications
Food And Nutrition Essay Topics
- How various food systems affect the sustainability metrics in place
- The impacts of malnutrition and food waste in developing nations
- Why the growing pressure on climate is affecting food and nutrition
- Demystifying myths and realities related to plant-based proteins
- The role of regulation in balancing consumer beliefs
- Does ingredient dosage matter in food and nutrition?
- How to develop proactive health based on science
- The impact of fasting on one’s health standards
- The role of misinformation on unhealthy eating habits
- How nutrients affect the microbiologically active parts of the body
College Sports Nutrition Topics For Research
- Demystify the various myths about taking carbohydrates before exercise
- Impacts of the use of creatine and caffeine in sports
- The role of enhancing appetite-regulating hormones among sportsmen
- How food and nutrition contribute to acute exercise-induced injuries
- The role of nutrients: A case of the central nervous system and direct muscles
- Food supplements that enhance high-intensity sport performance
- Why athletes should not drink lots of water during exercise
- Nutrients that optimize performance and safety during exercise sessions
- How to determine nutrition policies for sports teams
- The role of muscle mass and body fat in sporting activities
First-Class Nutrition Research Paper Topics
- Discuss the hormonal and metabolic regulation systems of the body
- How the choice of food one takes can help prevent cancer
- Why nutrition and physical activity are necessary for healthy living
- Does nutrition for babies affect their future life?
- How nutrition affects the functioning and development of the brain
- The role of genetics and physiology in nutrition
- Challenges to implementing dietary guidelines
- Why personalized nutrition is essential for healthy eating habits
- The interaction between food nutrients and the immune system
- Biological determinants of eating habits
Interesting Nutrition Topics For Research Paper
- Why are cereals among the most consumed foods?
- What are the health implications of brown and white bread?
- Advantages of taking milk every morning
- Why fruits and vegetables are recommended after every meal
- Is there a difference in nutrient levels between dried and fresh fruits?
- Why it is unhealthy to take food additives
- How healthy are coconuts for your digestive system?
- What are the differences between red and white meat?
- Evaluate the health dangers of pasteurized milk
- Why milk is essential for the digestive system of babies after birth
Research Topics In Nutrition And Dietetics
- Determine healthy nutrition standards for the elderly population
- The role of herbal supplementation in the body
- The relationship between eating and body image
- Impact of nicotine on nutrition habits
- Perceived attitudes towards fast food restaurants
- Causes of disordered eating habits
- Nutrients necessary during cardiac rehabilitation exercises
- Promoting healthy eating during the coronavirus pandemic
- Impact of social marketing programs on what is cooked in homes
- Challenges to pilot nutrition programs
Latest Research Topics In Nutrition
- How to increase the consumption of fruits among the general population
- Evaluate eating habits among college students
- Urban versus rural nutrition programs
- The role of nutrition for nursing students
- How organic food affects growth and body development
- Health indicators that determine eating habits
- Nutrition and performance in class
- Emotional brain formation and nutrition
- Effects of homemade food
- Intuitive eating habits
Research Paper Topics For Nutrition Class
- Relationship between income and nutrition
- Culture and nutrition
- Electronic media and nutrition
- Pathogens and nutrition
- Cigarette consumption and nutrition
- Food insecurity
- Nutritional problems in pregnant women
- Diet and physical activity
- Rural nutrition education
- Autism and nutrition
Research Topics In Clinical Nutrition
- Nutrition and blood pressure
- Food tubes for critical care patients
- Evidence-based nutrition programs
- Nutritional counseling
- Medical nutrition therapy
- Oral branched-chain amino acid supplementation
- Thiamine supplementation
- Nutrition and HIV/AIDS
- Diet and chronic disease prevention
- Aging and nutrition
Do you want more professional nutrition topics? Use our affordable homework help today and see the change!
Topics in Clinical Nutrition
- Subscribe to journal Subscribe
- Get new issue alerts Get alerts
Secondary Logo
Journal logo, current issue.
July/September 2024 - Volume 39 - Issue 3
- Editor-in-Chief: Kelly A. Kane, MS, RD, LDN, CNSC
- ISSN: 0883-5691
- Online ISSN: 1550-5146
- Frequency: 4 issues / year
- Ranking: Nutrition and Dietetics: 104/114
- Impact Factor: 0.4
Colleague's E-mail is Invalid
Your message has been successfully sent to your colleague.
Save my selection
Current Issue Highlights
- From the Editor’s Desk
Topics in Clinical Nutrition. 39(3):183, July/September 2024.
- Permissions
- Original Article
Contribution to the Validation of the Portuguese Version of the “Barriers to Enterally Feeding Critically Ill Patients” Questionnaire and Its Application in a Hospital Context
Topics in Clinical Nutrition. 39(3):184-197, July/September 2024.
- Abstract Abstract
Go to Full Text of this Article
The Value of Metabolites and Vitamins for the Assessment of Nutritional Status in Hospitalized Patients: A Systematic Review
Topics in Clinical Nutrition. 39(3):198-212, July/September 2024.
- Review Article
The Effect of the Single-Anastomosis Duodeno-Ileal Bypass With Sleeve Gastrectomy (SADI-S) on Circulating Concentrations of 25-OH Vitamin D and B 12 at 1 Year Postsurgery: A Literature Review
Topics in Clinical Nutrition. 39(3):259-273, July/September 2024.
- 12</sub> at 1 Year Postsurgery: A Literature Review', '06252024', 'Jane Sylvestre, Melanie Newkirk, Hamed Samavat, et al', '39', '3', '\u00A9 2024 Wolters Kluwer Health, Inc. All rights reserved.', '00008486-202407000-00008', '', false, '')" href="javascript:"> Permissions
Manuscript Check
Prior to submitting, we recommend that you run your manuscript through the Paperpal Preflight service, which instantly checks your manuscript and helps you address the most common errors and omissions.
Publish Open Access
Learn more about publishing your article open access in this Journal.
Benefits of publishing open access include:
- Unrestricted online access to your article
- Rigorous peer review
- Authors retain copyright
- Easy compliance with open access mandates
Featured Jobs
Latest articles.
View More Recent Articles
DigitalCommons@University of Nebraska - Lincoln
Home > Nutrition and Health Sciences > Dissertations, Theses, and Student Research
Nutrition and Health Sciences, Department of
Department of nutrition and health sciences: dissertations, theses, and student research.
Impact of the Department of Defense Maternity Leave Policy Change on Retention and Postpartum Depression and the Air Force Postpartum Physical Fitness Policy Change on Physical Readiness Outcomes , Minette S. R. Herrick
Studies of the Role of mTORC1 in Modulating Intestinal Epithelial Barrier Function , Isaac Adediji
The Effects of Exercise on the Lipid Profile of Extracellular Vesicles , Tesha Kerr
Bovine Mammary Alveolar MAC-T Cells Afford a Tool for Studies of Bovine Milk Exosomes in Drug Delivery. , Mojisola Ogunnaike
MOTHERS’ EXPERIENCE WITH INFANT COMPLEMENTARY FEEDING PRACTICES: A PHENOMENOLOGICAL STUDY. , Tyler Martin
Metabolic Benefits of Plant-based N-3 Polyunsaturated Fatty Acids on Brown Thermogenesis , Kyung Ho Park
Transport and Distribution of Bovine Milk Exosomes and miR-34a Cargo in Murine Cerebral Cortex Endothelial bEnd.3 Cells and BV2 Microglia , Pearl Ebea
3-Hydroxy Fatty Acids Induce Retinal Pigment Epithelial Cell Lipoapoptosis , Mona Hadidi
Inhibitory Effects Of Shiitake-derived Exosome-like Nanoparticles On NLRP3 Inflammasome Activation , Yizhu Lu
Concentrations of Purine Metabolites Are Elevated in Human Fluids from Adults and Infants and in Livers from Mice Fed Diets Depleted of Bovine Milk Exosomes and their RNA Cargos , Ana Aguilar Lozano
Choose Healthy Here Pilot Program: A Secondary Analysis of Consumers' Behaviors and Perceptions to Access and Affordability of Healthy Foods , Lindsey R. Anderson
The Effect of Change in Middle School Lunchroom Setting on Student’s Intake of Broccoli , Mia Wood Angst
The Relationship Between Habitual Physical Activity and Food Choices , Safiya E. Beckford
Maternal n-3 Polyunsaturated Fatty Acids Supplementation Potentiates Brown Adipose Tissue Development And Reduces The Risk Of Childhood Obesity , Rong Fan
CHAMPS: Child Health and Methods of Parenting Study , Megan Fletcher
Effects of Static, Countermovement, and Drop Jump Performance on Power and Rate of Force Development in 6 - 16 Year Old Boys , Lacey E. Jahn
Effects of Vagotomy and Fenugreek on Hyperlipidemia and Insulin Resistance , Rituraj Khound
Adaptive Thermogenesis and Metabolic Changes Following Diet- and Exercise- Induced Weight Loss , Alexandra R. Martin
Attenuating the Side Effects of Caloric Restriction Through Exercise and Increased Protein Intake , Jay A. Petersen
Red Grain Sorghum Whole Kernel Crude Lipid Protects Energy Metabolism And Short Chain Fatty Acid Profile In A Hamster Model To Minimize Intestinal Stress Caused By A High Fat Diet , Haowen Qiu
UNIVERSITY WELLNESS: A NUMBERS GAME – HOW HEALTH NUMBERS RELATE TO BLOOD PRESSURE , Courtney B. Schnell
ASSESSMENT OF THE CAMPUS FOOD ENVIRONMENT USING COMPONENTS OF THE HEALTHY CAMPUS ENVIRONMENTAL AUDIT , Candace Sorden
The Effect of a Youth Cooking Intervention on Nutrition Knowledge and Healthy Eating Behaviors among 4th & 5th Graders Attending Title I Schools , Ashley B. Walther
We Cook: Fun with Food and Fitness: Impact of a Youth Cooking Program on the Home Environment , Courtney Warday
CHARACTERIZATION OF EXTRACTION METHODS TO RECOVER PHENOLIC-RICH EXTRACTS FROM BLACK BEANS ( PHASEOLUS VULGARIS ) THAT INHIBIT ALPHA-AMYLASE AND ALPHA-GLUCOSIDASE USING RESPONSE SURFACE APPROACHES , Mazen Alharbi
SYNBIOTIC ICE CREAM AS A PROBIOTIC CARRIER TESTED IN A HUMAN BLIND CROSSOVER TRIAL , Erin M. McNamara
The Relationships between the Home Food Environment and Weight Status among Children and Adolescents, ages 6-17 years , Martha J. Nepper
Relationships between Parental Energy Balance-Related Behaviors and their Child’s Weight Status and Performance on FITNESSGRAM® In-School Assessment , Kathryn M. Painter
iCook 4-H Intervention: Food-Related Behavior and Intake of Adult Main Meal Preparers Participating in a 5-State Childhood Obesity Prevention Study , Kyla A. Richardson
Mechanism of Triglyceride Lowering Action of Akkermansia muciniphila and Fenugreek in a Genetic Induced Hyperlipidemia , Jing Shen
Time Course of Changes in Neuromuscular Parameters during Fatiguing High-Load and Low-Load Concentric Dynamic Constant External Resistance Leg Extension Muscle Actions , Cory M. Smith
MICRORNAs ARE ABSORBED IN BIOLOGICALLY MEANINGFUL AMOUNTS FROM NUTRITIONALLY RELEVANT DOSES OF COW’S MILK AND CHICKEN EGGS AND AFFECT GENE EXPRESSION IN PERIPHERAL BLOOD MONONUCLEAR CELLS, CELL CULTURES, AND MOUSE LIVERS , Scott Baier
CHARACTERIZING THE EFFECTS OF BOTH SYNTHETIC AND NATURAL INHIBITORS ON THE FUNCTION OF HOLOCARBOXYLASE SYNTHETASE AND LIPID METABOLISM , Elizabeth Cordonier
THE EFFECTIVENESS OF EDUCATIONAL DISPLAYS RELATED TO FOODBORNE ILLNESS IN INFANTS , Krista M. Godfrey
An Evaluation and Exploration of Nutrition Education in Elementary Schools , Elisha M. Hall
Stability and Biological Activity of Dietary MicroRNAs , Katherine Howard
TRANSPORT OF BOVINE MILK EXOSOMES IN HUMAN ENDOTHELIAL CELL , Rio Jati Kusuma
ATTENUATION OF mTORC1-DRIVEN SECRETION OF LIPOPROTEINS AND TRIACYLGLYCERIDES BY SHORT CHAIN FATTY ACIDS: MECHANISTIC INSIGHT INTO THE PATHOGENESIS OF HYPERTRIGLYCERIDEMIA , Joseph L. Roberts
Discovery Neighborhood MyPlate Macy: A Pilot Study , Amanda M. Robine
ASSESSING THE SOCIOCULTURAL IMPACT OF SPECIAL EVENTS IN THE CONTEXT OF GERMANFEST IN NEBRASKA, USA , Yanli Wang
TRANSPORT OF BOVINE MILK EXOSOMES BY HUMAN COLON CARCINOMA CACO-2 CELLS AND RAT SMALL INTESTINAL IEC-6 CELLS , Tovah Wolf
Physiological Responses at the Critical Heart Rate During Treadmill Running , Haley Bergstrom
PEER HEALTH TEACHING IMPROVES NUTRITION BEHAVIORS IN THE TEEN TEACHER POPULATION , Ashlie Smith
The CREBH in hepatic lipid and lipoprotein metabolism: Implication for the pathogenesis of hyperlipidemia and metainflammation , Miaoyun Zhao
Assessment of the Nutrition and Physical Activity Education Needs of Child Care Providers Across Nebraska , Tracy C. Delaney
DEVELOPMENT OF FOOD SAFETY EDUCATION AND PILOT STUDY SPECIFICALLY FOR NATIVE AMERICANS AUDIENCES , Kristine M. Foley
A Pilot Mixed Methods Evaluation Study of the Effectiveness of an After-School Cooking Club Curriculum for Middle School Students , Elisha M. Hall
TEST-RETEST RELIABILITY FOR VOLUNTARY AND EVOKED MEASURES OF PEAK TORQUE, ELECTROMECHANICAL DELAY, AND RATE OF TORQUE DEVELOPMENT IN OLDER MEN. , Nathaniel D.M. Jenkins
Reliability and validity of a culturally appropriate food frequency questionnaire to measure the omega-3 fatty acid intakes of Midwestern African American women of childbearing age , Narissa Scales
A Mixed Methods Approach to Evaluate KidQuest, a Traditional Classroom Obesity Prevention Intervention, in an Afterschool Program: A Pilot Study , Amy M. Wehbe
STUDIES ON THE REGULATION OF FGF21 GENE EXPRESSION BY (R)-α-LIPOIC ACID: MECHANISTIC INSIGHT INTO THE LIPID LOWERING PROPERTIES OF A DITHIOL DIETARY MOLECULE , Xiaohua Yi
Biotinylation of the c-Myc promoter binding protein MBP-1 decreases c-Myc and COX-2 expression in mammary carcinoma MCF-7 cells , Jie Zhou
Eating Patterns and Physical Activity Characteristics Among Urban and Rural Students in Saudi Arabia , Omar I. Abuzaid
Breakfast Consumption Habits of Youth Living in Low Income Neighborhoods in a Large Three County Metropolitan Area , Elijah Dacy
Dietitian’s Problem Solving Knowledge to Promote and Support Breastfeeding , Cassandra L. Dytrych
Identification and Assessment of Markers of Biotin Status in Healthy Adults , Wei Kay Eng
Attitudes Of College Students In Relationship To Weight And Physical Activity , Emily N. Estes
Evaluation of a Social Marketing Campaign: 4 Day Throw Away , Katie J. James
Body Mass Index Trends and Nutrition Goals of College Students between 2007-2011 , Alison L. Lynn
Impact of the Home Food Environment on Dietary Intake, Obesity and Cardiovascular Health of U.S. Children and Adolescents, Aged 6-19 , Melissa A. Masters
School Food Environment the Frontline for Childhood Obesity Prevention: A Mixed-Method Study of Nutritional Competencies and Skills of School Nutriiton Professionals in Nebraska , Zainab Rida
Mixed Methods Analysis of School Wellness Programs in Nebraska and Indiana: A Descriptive Study , Jessica A. Robinson
ASSESSMENT OF NUTRITION KNOWLEDGE AND SELF-EFFICACY OF NCAA ATHLETES , Melissa M. Wallinga
A New Single Workbout Test to Estimate Critical Power and Anaerobic Work Capacity , Haley Bergstrom
PRESCHOOL CHILDREN’S WILLINGNESS TO TRY AND PREFERENCE FOR DOCOSAHEXAENOIC ACID OMEGA-3 FOODS , Bethany JoAnn Bettenhausen
Mechanisms of decreased cholesterol absorption mediated by phytosterols in the intestinal lumen , Andrew W. Brown
Regulation of Sterol Transport by Dietary Phytosterol Esters , Trevor J. Carden
Effects of Single Nucleotide Polymorphisms in the Human Holocarboxylase Synthetase Gene on Catalytic Activity , Shingo Esaki
Intent of Expecting Fathers to Encourage Breastfeeding, Perceptions of Support and Barriers to Encouraging Breastfeeding , Katrina Harwood
Omega-3 Dietary Intakes, Knowledge, And Attitudes In Patients Screened For Colon Cancer , Cindy Kaminski
Intervention to Increase Knowledge and Consumption of Folate-rich Foods Based on the Health Belief Model , Lindsay M. LaBrosse
FARM TO SCHOOL: A CASE STUDY OF FOUR RURAL NEBRASKA SCHOOLS BEFORE INITIATING LOCALLY GROWN FOODS IN SCHOOL FOOD SERVICE , Morgan Swisher
SENSORY EVALUATION OF ICE CREAM MADE WITH PREBIOTIC INGREDIENTS SUBSTITUTED FOR SUGAR , Jennifer M. Wood
Perceived Importance and Actual Intake of Calcium and Vitamin D in Young Female Athletes , Miriam E. Zambrano
Modulation of Lipid Metabolism by Phytosterol Stearates and Black Raspberry Seed Oils , Mark McKinley Ash
UNSATURATED FATTY ACIDS REPRESS THE EXPRESSION OF ADIPOSE FATTY ACID-BINDING PROTEIN, aP2, IN RAW 264.7 MACROPHAGE , Sara L. Coleman
A Pilot Study of the Relationship of Calcium Intake and Frequency of Injuries In High School Athletes , Jeffrey K. Ebert
Qualitative Study to Determine Quality of Life Factors Based on Reported EFNEP Sucess Stories , Megan L. Hlavacek
Assessing Dietary Intake, Eating and Exercise Attitudes and Fitness Levels in College-Aged Students , Katie J. James
Youth School Enrichment Nutrition Programming in Nebraska: A Descriptive Study , Ashley M. Keller
REGULATION OF ATP BINDING CASSETTE TRANSPORTER A1 AND G1 EXPRESSION BY FATTY ACIDS , Chai Siah Ku
A Qualitative Analysis of Youth Feedback of Nutrition School Enrichment Kits in Lincoln, NE , Richard A. Losey
Food Handling Practices, Knowledge and Beliefs of Families with Young Children Based on the Health Belief Model , Adeline Lum
Cardiovascular Disease Risk Factors and Associations with Indicators of Body Fat, Diet, and Physical Activity in U.S. Children Ages 6-11 , Melissa A. Masters
A CURRENT EXAMINATION OF DIETARY INTAKES OF FIBER, CALCIUM, IRON, AND ZINC AND THEIR RELATIONSHIP TO BLOOD LEAD LEVELS IN U.S. CHILDREN AGED 1-5 YEARS , Stephanie A. Melchert
A Pilot Study to Determine the Effectiveness of Probiotic Use in Elderly Patients with Antibiotic-Associated Diarrhea , Jenna L. Peate
Holocarboxylase Synthetase-dependent Biotinylation of Histone H4 , Luisa F. Rios Avila
LEADERSHIP DEVELOPMENT OF REGISTERED DIETITIANS , Anne Marie Bigley Hunter
Content Validation of Nutrition Diagnostic Term Involuntary Weight Loss by Board Certified Specialists in Gerontological Nutrition , Paula K. Ritter-Gooder
Omega-3 Fatty Acids Website Development for Registered Dietitian Education and Research , Martha M. Valverde
Web-Based Nutrition Education for University Middle-Aged Female Staff , Wan-Ju Yen
Advanced Search
Search Help
- Notify me via email or RSS
- Administrator Resources
- How to Cite Items From This Repository
- Copyright Information
- Collections
- Disciplines
Author Corner
- Guide to Submitting
- Submit your paper or article
- Dissertations, Theses, and Student Research Website
Home | About | FAQ | My Account | Accessibility Statement
Privacy Copyright
- Bibliography
- More Referencing guides Blog Automated transliteration Relevant bibliographies by topics
- Automated transliteration
- Relevant bibliographies by topics
- Referencing guides
Nutrition in Pancreatic Diseases: The Role of Nutritional Status and Nutrition Therapy in the Management of Pancreatitis and Pancreatic Cancer
Total Downloads
Total Views and Downloads
About this Research Topic
The pancreas plays a crucial role in nutrient digestion and assimilation. Along the continuum of pancreatic diseases, an ambiguous relation with nutritional status exists. While obesity is a known risk factor for severe acute pancreatitis and pancreatic cancer, inflammation as well as an impaired exocrine and endocrine pancreatic function put patients at an increased risk of malnutrition and especially muscle loss. Because both excess body weight and disease-related malnutrition are associated with increased morbidity and mortality, adequate nutritional management of patients with pancreatic diseases is of key importance. However, there is still limited knowledge on the specific effects of nutritional status on disease outcome and the optimal modalities of nutrition therapy along the continuum of pancreatitis and pancreatic cancer. This Research Topic aims to shed light on the importance of proper nutritional status and adequate nutritional management in pancreatic diseases. By collecting research dedicated to these questions, we seek to augment evidence on these aspects along the continuum of pancreatic diseases. This collection of research will eventually allow for strengthening recommendations and identifying novel treatment options both in the management of acute and chronic pancreatitis as well as pancreatic cancer. Here, we welcome especially original research works reporting results from both observational studies and clinical trials. Research should deal with nutritional aspects in the prevention or management of acute, and chronic pancreatitis, or pancreatic cancer. To facilitate evidence-based practice, we further appreciate contributions in the form of systematic reviews and meta-analyses that aggregate findings from previous studies dedicated to the aforementioned topics. Moreover, authors are also invited to submit their preclinical or translational research that addresses the pathophysiological and mechanistic aspects of nutrition and nutritional status in pancreatic diseases.
Keywords : Pancreas, Pancreatitis, Pancreatic Cancer, Malnutrition, Sarcopenia, Muscle Loss, Nutrition Therapy, Supplementation
Important Note : All contributions to this Research Topic must be within the scope of the section and journal to which they are submitted, as defined in their mission statements. Frontiers reserves the right to guide an out-of-scope manuscript to a more suitable section or journal at any stage of peer review.
Topic Editors
Topic coordinators, submission deadlines.
Manuscript Summary | |
Manuscript |
Participating Journals
Manuscripts can be submitted to this Research Topic via the following journals:
total views
- Demographics
No records found
total views article views downloads topic views
Top countries
Top referring sites, about frontiers research topics.
With their unique mixes of varied contributions from Original Research to Review Articles, Research Topics unify the most influential researchers, the latest key findings and historical advances in a hot research area! Find out more on how to host your own Frontiers Research Topic or contribute to one as an author.
Home » Blog » Dissertation » Topics » Food and Nutrition » Food and Nutrition dissertation topics (27 Examples) For Research
Food and Nutrition dissertation topics (27 Examples) For Research
Mark Jun 19, 2020 Jun 18, 2020 Food and Nutrition No Comments
Food and nutrition is a broad and competitive field in the health area as it has a strong impact on the development and performance of the human body. If you are searching for an interesting topic for dissertation and research projects related to food and nutrition, we have developed a list of food and nutrition […]
Food and nutrition is a broad and competitive field in the health area as it has a strong impact on the development and performance of the human body. If you are searching for an interesting topic for dissertation and research projects related to food and nutrition, we have developed a list of food and nutrition dissertation topics.
You can select a topic from the list of food and nutrition dissertation topics that you find interesting to work on. We understand the role of good dissertation topics in the academic success of nutritionist students. So, we have compiled some very interesting research topics on food and nutrition and project topics on food and nutrition.
list of food and nutrition dissertation topics
The digestive wellness and the emerging science.
The importance of eating more plant foods.
How does technology promote healthy eating?
The emergence of the fad diets and its impact on the health and wellbeing.
A review of different types of food fears.
A review of the future of nutrigenomics.
An image-based dietary assessment and its benefits.
The emergence of the concept of ketogenic diets – case analysis.
The importance of fasting and time-restricted eating.
A review of the concept of nutrition and HIV.
Should schools ban unhealthy packed lunches?
Studying the cost and impact of type 2 diabetes: policy recommendations.
The importance of the first 1000 days of life – maternal and child nutrition.
A qualitative analysis of the nutritional evaluation of a healthy eating intervention in primary school children in socioeconomically challenged areas.
Analysing the concept of food for thought considering the mental health and nutrition briefing.
A literature review on self-efficacy of dietary choices and the dietary intake among rural adolescents in the UK.
A literature review on nutrition as hard food science.
Nutritional health status of adults in the UK based on occupations.
Exploring the food-based approaches toward community nutrition and health.
An analysis of the relationship between diet and mental health.
To investigate the different food system solutions to deal with malnutrition.
An evaluation of the impact of poverty and food insecurity on the health and wellbeing of people.
The importance of providing dietary guidance to people with chronic illnesses.
The role of the government of countries in promoting food safety, health, and wellbeing in the country – a comparative analysis.
The role of food systems in enhancing human health and development.
An evaluation of the diabetes self-management program and diet control.
A comparative review of different types of diets recommended by physicians and dieticians.
Topic With Mini-Proposal (Paid Service)
Along with a topic, you will also get;
- An explanation why we choose this topic.
- 2-3 research questions.
- Key literature resources identification.
- Suitable methodology with identification of raw sample size, and data collection method
- View a sample of topic consultation service
Get expert dissertation writing help to achieve good grades
- Writer consultation before payment to ensure your work is in safe hands.
- Free topic if you don't have one
- Draft submissions to check the quality of the work as per supervisor's feedback
- Free revisions
- Complete privacy
- Plagiarism Free work
- Guaranteed 2:1 (With help of your supervisor's feedback)
- 2 Instalments plan
- Special discounts
Other Posts
Message Us On WhatsApp
Information
- Author Services
Initiatives
You are accessing a machine-readable page. In order to be human-readable, please install an RSS reader.
All articles published by MDPI are made immediately available worldwide under an open access license. No special permission is required to reuse all or part of the article published by MDPI, including figures and tables. For articles published under an open access Creative Common CC BY license, any part of the article may be reused without permission provided that the original article is clearly cited. For more information, please refer to https://www.mdpi.com/openaccess .
Feature papers represent the most advanced research with significant potential for high impact in the field. A Feature Paper should be a substantial original Article that involves several techniques or approaches, provides an outlook for future research directions and describes possible research applications.
Feature papers are submitted upon individual invitation or recommendation by the scientific editors and must receive positive feedback from the reviewers.
Editor’s Choice articles are based on recommendations by the scientific editors of MDPI journals from around the world. Editors select a small number of articles recently published in the journal that they believe will be particularly interesting to readers, or important in the respective research area. The aim is to provide a snapshot of some of the most exciting work published in the various research areas of the journal.
Original Submission Date Received: .
- Active Journals
- Find a Journal
- Proceedings Series
- For Authors
- For Reviewers
- For Editors
- For Librarians
- For Publishers
- For Societies
- For Conference Organizers
- Open Access Policy
- Institutional Open Access Program
- Special Issues Guidelines
- Editorial Process
- Research and Publication Ethics
- Article Processing Charges
- Testimonials
- Preprints.org
- SciProfiles
- Encyclopedia
Article Menu
- Subscribe SciFeed
- Recommended Articles
- Author Biographies
- Google Scholar
- on Google Scholar
- Table of Contents
Find support for a specific problem in the support section of our website.
Please let us know what you think of our products and services.
Visit our dedicated information section to learn more about MDPI.
JSmol Viewer
Sulfate nutrition modulates the oxidative response against short-term al 3+ -toxicity stress in lolium perenne cv. jumbo shoot tissues.
Graphical Abstract
1. Introduction
2. material and methods, 2.1. experimental growth conditions and plant leaves tissue collection, 2.2. aluminum, calcium, and magnesium estimation in plant leaves via atomic absorption spectroscopy (aas), 2.3. sulfur estimation in l. perenne leaves via gravimetry, 2.4. lipid peroxidation measurements, 2.5. ascorbic acid and dehydroascorbic acid quantitation, 2.6. quantitation of oxidized (gssg) and reduced (gsh) glutathione in leaves of l. perenne, 2.7. protein extraction from l. perenne leaf tissue and calculation of ros enzymatic activities, 2.8. total rna extraction from leaves of lolium perenne and qrt-pcr assays, 2.9. statistical analysis, 3.1. sulfate supplementation modulates total proteins, calcium, magnesium and tbars concentration in leaves of plants subjected to al 3+ toxicity, 3.2. sulfate supplementation modulated photosynthetic response in leaves of plants subjected to al 3+ toxicity, 3.3. sulfate supply modulates antioxidant metabolites in shoots of l. perenne cv. jumbo exposed to al 3+ toxicity, 3.4. sulfate supplementation modulates enzyme activity and gene expression of ros scavenging enzymes in shoots of l. perenne cv. jumbo exposed to al 3+ toxicity, 4. discussion, 4.1. adequate sulfate supply recovered membrane damage, and mineral uptake; but not total protein amount after al 3+ toxicity exposure, 4.2. adequate sulfate supplementation was able to maintain photosynthetic parameters in leaves of l. perennial cv. jumbo exposed to al 3+ toxicity, 4.3. sulfate supplementation activates ros defense mechanism in leaves of l. perennial cv. jumbo exposed to al 3+ toxicity, 5. conclusions, supplementary materials, author contributions, data availability statement, acknowledgments, conflicts of interest.
- von Uexküll, H.R.; Mutert, E. Global Extent, Development and Economic Impact of Acid Soils. Plant Soil 1995 , 171 , 1–15. [ Google Scholar ] [ CrossRef ]
- Raza, S.; Zamanian, K.; Ullah, S.; Kuzyakov, Y.; Virto, I.; Zhou, J. Inorganic Carbon Losses by Soil Acidification Jeopardize Global Efforts on Carbon Sequestration and Climate Change Mitigation. J. Clean. Prod. 2021 , 315 , 128036. [ Google Scholar ] [ CrossRef ]
- Nachtergaele, F. Soil Taxonomy—A Basic System of Soil Classification for Making and Interpreting Soil Surveys. Geoderma 2001 , 99 , 336–337. [ Google Scholar ] [ CrossRef ]
- Aguilera, S.M.; Borie, G.; Peirano, P.; Galindo, G. Organic Matter in Volcanic Soils in Chile: Chemical and Biochemical Characterization. Commun. Soil Sci. Plant Anal. 1997 , 28 , 899–912. [ Google Scholar ] [ CrossRef ]
- Shetty, R.; Vidya, C.S.N.; Prakash, N.B.; Lux, A.; Vaculík, M. Aluminum Toxicity in Plants and Its Possible Mitigation in Acid Soils by Biochar: A Review. Sci. Total Environ. 2021 , 765 , 142744. [ Google Scholar ] [ CrossRef ] [ PubMed ]
- Yamamoto, Y. Aluminum Toxicity in Plant Cells: Mechanisms of Cell Death and Inhibition of Cell Elongation. Soil Sci. Plant Nutr. 2019 , 65 , 41–55. [ Google Scholar ] [ CrossRef ]
- Poschenrieder, C.; Gunsé, B.; Corrales, I.; Barceló, J. A Glance into Aluminum Toxicity and Resistance in Plants. Sci. Total Environ. 2008 , 400 , 356–368. [ Google Scholar ] [ CrossRef ]
- Matsumoto, H. Cell Biology of Aluminum Toxicity Tolerance in Higher Plants. Int. Rev. Cytol. 2000 , 200 , 1–46. [ Google Scholar ]
- Llugany, M.; Poschenrieder, C.; Barceló, J. Monitoring of Aluminium-induced Inhibition of Root Elongation in Four Maize Cultivars Differing in Tolerance to Aluminium and Proton Toxicity. Physiol. Plant. 1995 , 93 , 265–271. [ Google Scholar ] [ CrossRef ]
- Silva, I.R.; Smyth, T.J.; Moxley, D.F.; Carter, T.E.; Allen, N.S.; Rufty, T.W. Aluminum Accumulation at Nuclei of Cells in the Root Tip. Fluorescence Detection Using Lumogallion and Confocal Laser Scanning Microscopy. Plant Physiol. 2000 , 123 , 543–552. [ Google Scholar ] [ CrossRef ]
- He, H.; Li, Y.; He, L.F. Aluminum Toxicity and Tolerance in Solanaceae Plants. S. Afr. J. Bot. 2019 , 123 , 23–29. [ Google Scholar ] [ CrossRef ]
- Cartes, P.; McManus, M.; Wulff-Zottele, C.; Leung, S.; Gutiérrez-Moraga, A.; Mora, M. de la L. Differential Superoxide Dismutase Expression in Ryegrass Cultivars in Response to Short Term Aluminium Stress. Plant Soil 2012 , 350 , 353–363. [ Google Scholar ] [ CrossRef ]
- Frantzios, G.; Galatis, B.; Apostolakos, P. Aluminium Effects on Microtubule Organization in Dividing Root-Tip Cells of Triticum Turgidum. II. Cytokinetic Cells. J. Plant Res. 2001 , 114 , 157–170. [ Google Scholar ] [ CrossRef ]
- Horst, W.J.; Wang, Y.; Eticha, D. The Role of the Root Apoplast in Aluminium-Induced Inhibition of Root Elongation and in Aluminium Resistance of Plants: A Review. Ann. Bot. 2010 , 106 , 185–197. [ Google Scholar ] [ CrossRef ] [ PubMed ]
- Yin, L.; Mano, J.; Wang, S.; Tsuji, W.; Tanaka, K. The Involvement of Lipid Peroxide-Derived Aldehydes in Aluminum Toxicity of Tobacco Roots. Plant Physiol. 2010 , 152 , 1406–1417. [ Google Scholar ] [ CrossRef ]
- Yamamoto, Y.; Kobayashi, Y.; Matsumoto, H. Lipid Peroxidation Is an Early Symptom Triggered by Aluminum, but Not the Primary Cause of Elongation Inhibition in Pea Roots. Plant Physiol. 2001 , 125 , 199–208. [ Google Scholar ] [ CrossRef ] [ PubMed ]
- Yamamoto, Y.; Kobayashi, Y.; Devi, S.R.; Rikiishi, S.; Matsumoto, H. Aluminum Toxicity Is Associated with Mitochondrial Dysfunction and the Production of Reactive Oxygen Species in Plant Cells. Plant Physiol. 2002 , 128 , 63–72. [ Google Scholar ] [ CrossRef ]
- Wulff-Zottele, C.; Hesse, H.; Fisahn, J.; Bromke, M.; Vera-Villalobos, H.; Li, Y.; Frenzel, F.; Giavalisco, P.; Ribera-Fonseca, A.; Zunino, L.; et al. Sulphate Fertilization Ameliorates Long-Term Aluminum Toxicity Symptoms in Perennial Ryegrass ( Lolium perenne ). Plant Physiol. Biochem. 2014 , 83 , 88–99. [ Google Scholar ] [ CrossRef ]
- Reyes-Díaz, M.; Inostroza-Blancheteau, C.; Millaleo, R.; Cruces, E.; Wulff-Zottele, C.; Alberdi, M.; de la Luz Mora, M. Long-Term Aluminum Exposure Effects on Physiological and Biochemical Features of Highbush Blueberry Cultivars. J. Am. Soc. Hortic. Sci. 2010 , 135 , 212–222. [ Google Scholar ] [ CrossRef ]
- Reyes-Diaz, M.; Alberdi, M.; Mora, M.D.L.L. Short-Term Aluminum Stress Differentially Affects the Photochemical Efficiency of Photosystem II in Highbush Blueberry Genotypes. J. Am. Soc. Hortic. Sci. 2009 , 134 , 14–21. [ Google Scholar ] [ CrossRef ]
- Cheng, X.; Fang, T.; Zhao, E.; Zheng, B.; Huang, B.; An, Y.; Zhou, P. Protective Roles of Salicylic Acid in Maintaining Integrity and Functions of Photosynthetic Photosystems for Alfalfa ( Medicago sativa L.) Tolerance to Aluminum Toxicity. Plant Physiol. Biochem. 2020 , 155 , 570–578. [ Google Scholar ] [ CrossRef ]
- Phukunkamkaew, S.; Tisarum, R.; Pipatsitee, P.; Samphumphuang, T.; Maksup, S.; Cha-um, S. Morpho-Physiological Responses of Indica Rice ( Oryza sativa Sub. indica) to Aluminum Toxicity at Seedling Stage. Environ. Sci. Pollut. Res. 2021 , 28 , 29321–29331. [ Google Scholar ] [ CrossRef ]
- Ofoe, R.; Thomas, R.H.; Asiedu, S.K.; Wang-Pruski, G.; Fofana, B.; Abbey, L. Aluminum in Plant: Benefits, Toxicity and Tolerance Mechanisms. Front. Plant Sci. 2023 , 13 , 1085998. [ Google Scholar ] [ CrossRef ] [ PubMed ]
- Guo, P.; Li, Q.; Qi, Y.P.; Yang, L.T.; Ye, X.; Chen, H.H.; Chen, L.S. Sulfur-Mediated-Alleviation of Aluminum-Toxicity in Citrus Grandis Seedlings. Int. J. Mol. Sci. 2017 , 18 , 2570. [ Google Scholar ] [ CrossRef ] [ PubMed ]
- Ritchey, K.D.; Snuffer, J.D. Limestone, Gypsum, and Magnesium Oxide Influence Restoration of an Abandoned Appalachian Pasture. Agron. J. 2002 , 94 , 830–839. [ Google Scholar ] [ CrossRef ]
- Demanet-Fillipi, R. Enmiendas Calcareas. Plant Lechero Watt´s. Chile. Bulletin N°2. April 2017. Available online: https://www.watts.cl/docs/default-source/charlas-a-productores/enmienda-calcarea.pdf?sfvrsn=4 (accessed on 30 October 2023).
- Meriño-Gergichevich, C.; Alberdi, M.; Ivanov, A.G.; Reyes-Díaz, M. Al 3+ -Ca 2+ Interaction in Plants Growing in Acid Soils: Al-Phytotoxicity Response to Calcareous Amendments. J. Soil Sci. Plant Nutr. 2010 , 10 , 217–243. [ Google Scholar ]
- Toma, M.; Sumner, M.E.; Weeks, G.; Saigusa, M. Long-term Effects of Gypsum on Crop Yield and Subsoil Chemical Properties. Soil Sci. Soc. Am. J. 1999 , 63 , 891–895. [ Google Scholar ] [ CrossRef ]
- Takahashi, T.; Ikeda, Y.; Nakamura, H.; Nanzyo, M. Efficiency of Gypsum Application to Acid Andosols Estimated Using Aluminum Release Rates and Plant Root Growth. Soil Sci. Plant Nutr. 2006 , 52 , 584–592. [ Google Scholar ] [ CrossRef ]
- Kinraide, T.B. Identity of the Rhizotoxic Aluminium Species. Plant Soil 1991 , 134 , 167–178. [ Google Scholar ] [ CrossRef ]
- Mora, M.L.; Cartes, P.; Demanet, R.; Cornforth, I.S. Effects of Lime and Gypsum on Pasture Growth and Composition on an Acid Andisol in Chile, South America. Commun. Soil Sci. Plant Anal. 2002 , 33 , 2069–2081. [ Google Scholar ] [ CrossRef ]
- Vera-Villalobos, H.; Lunario-Delgado, L.; Pérez-Retamal, D.; Román, D.; Leiva, J.C.; Zamorano, P.; Mercado-Seguel, A.; Gálvez, A.S.; Benito, C.; Wulff-Zottele, C. Sulfate Nutrition Improves Short-Term Al3+-Stress Tolerance in Roots of Lolium perenne L. Plant Physiol. Biochem. 2020 , 148 , 103–113. [ Google Scholar ] [ CrossRef ] [ PubMed ]
- Takahashi, H.; Kopriva, S.; Giordano, M.; Saito, K.; Hell, R. Sulfur Assimilation in Photosynthetic Organisms: Molecular Functions and Regulations of Transporters and Assimilatory Enzymes. Annu. Rev. Plant Biol. 2011 , 62 , 157–184. [ Google Scholar ] [ CrossRef ]
- Saito, K. Sulfur Assimilatory Metabolism. The Long and Smelling Road. Plant Physiol. 2004 , 136 , 2443–2450. [ Google Scholar ] [ CrossRef ] [ PubMed ]
- Zhu, C.Q.; Zhang, J.H.; Sun, L.M.; Zhu, L.F.; Abliz, B.; Hu, W.J.; Zhong, C.; Bai, Z.G.; Sajid, H.; Cao, X.C.; et al. Hydrogen Sulfide Alleviates Aluminum Toxicity via Decreasing Apoplast and Symplast al Contents in Rice. Front. Plant Sci. 2018 , 9 , 294. [ Google Scholar ] [ CrossRef ]
- Alarcón-Poblete, E.; Inostroza-Blancheteau, C.; Alberdi, M.; Rengel, Z.; Reyes-Díaz, M. Molecular Regulation of Aluminum Resistance and Sulfur Nutrition during Root Growth. Planta 2018 , 247 , 27–39. [ Google Scholar ] [ CrossRef ] [ PubMed ]
- Taylor, G.J.; Foy, C.D. Mechanisms of Aluminum Tolerance in Triticum aestivum L. (Wheat). I. Differential PH Induced by Winter Cultivars in Nutrient Solutions. Am. J. Bot. 1985 , 72 , 695–701. [ Google Scholar ] [ CrossRef ]
- Shaff, J.E.; Schultz, B.A.; Craft, E.J.; Clark, R.T.; Kochian, L.V. GEOCHEM-EZ: A Chemical Speciation Program with Greater Power and Flexibility. Plant Soil 2010 , 330 , 207–214. [ Google Scholar ] [ CrossRef ]
- Román-Silva, D.A.; Rivera, L.; Morales, T.; Ávila, J.; Cortés, P. Determination of Trace Elements in Environmental and Biological Samples Using Improved Sample Introduction in Flame Atomic Absorption Spectrometry (HHPN-AAS; HHPN-FF-AAS). Int. J. Environ. Anal. Chem. 2003 , 83 , 327–341. [ Google Scholar ] [ CrossRef ]
- Du, Z.; Bramlage, W.J. Modified Thiobarbituric Acid Assay for Measuring Lipid Oxidation in Sugar-Rich Plant Tissue Extracts. J. Agric. Food Chem. 1992 , 40 , 1566–1570. [ Google Scholar ] [ CrossRef ]
- Gillespie, K.M.; Ainsworth, E.A. Measurement of Reduced, Oxidized and Total Ascorbate Content in Plants. Nat. Protoc. 2007 , 2 , 871–874. [ Google Scholar ] [ CrossRef ]
- Rahman, I.; Kode, A.; Biswas, S.K. Assay for Quantitative Determination of Glutathione and Glutathione Disulfide Levels Using Enzymatic Recycling Method. Nat. Protoc. 2007 , 1 , 3159–3165. [ Google Scholar ] [ CrossRef ] [ PubMed ]
- Donahue, J.L.; Okpodu, C.M.; Cramer, C.L.; Grabau, E.A.; Alscher, R.G. Responses of Antioxidants to Paraquat in Pea Leaves: Relationships to Resistance. Plant Physiol. 1997 , 113 , 249–257. [ Google Scholar ] [ CrossRef ]
- Nakano, Y.; Asada, K. Hydrogen Peroxide Is Scavenged by Ascorbate-Specific Peroxidase in Spinach Chloroplasts. Plant Cell Physiol. 1981 , 22 , 867–880. [ Google Scholar ] [ CrossRef ]
- Ambuko, J.; Carmel Zanol, G.; Sekozawa, Y.; Sugaya, S.; Gemma, H. Reactive Oxygen Species (ROS) Scavenging in Hot Air Preconditioning Mediated Alleviation of Chilling Injury in Banana Fruits. J. Agric. Sci. 2012 , 5 , 319. [ Google Scholar ] [ CrossRef ]
- Aebi, H. [13] Catalase in vitro. Methods Enzymol. 1984 , 105 , 121–126. [ Google Scholar ] [ CrossRef ] [ PubMed ]
- Untergasser, A.; Ruijter, J.M.; Benes, V.; van den Hoff, M.J.B. Web-Based LinRegPCR: Application for the Visualization and Analysis of (RT)-QPCR Amplification and Melting Data. BMC Bioinform. 2021 , 22 , 398. [ Google Scholar ] [ CrossRef ]
- Schmittgen, T.D.; Livak, K.J. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2 −ΔΔCT Method. Methods 2001 , 25 , 402–408. [ Google Scholar ]
- Chen, W.W.; Tang, L.; Wang, J.Y.; Zhu, H.H.; Jin, J.F.; Yang, J.L.; Fan, W. Research Advances in the Mutual Mechanisms Regulating Response of Plant Roots to Phosphate Deficiency and Aluminum Toxsicity. Int. J. Mol. Sci. 2022 , 23 , 1137. [ Google Scholar ] [ CrossRef ]
- Correia, S.; Matos, M.; Ferreira, V.; Martins, N.; Gonçalves, S.; Romano, A.; Pinto-Carnide, O. Molecular Instability Induced by Aluminum Stress in Plantago Species. Mutat. Res./Genet. Toxicol. Environ. Mutagen. 2014 , 770 , 105–111. [ Google Scholar ] [ CrossRef ]
- Yang, M.; Tan, L.; Xu, Y.; Zhao, Y.; Cheng, F.; Ye, S.; Jiang, W. Effect of Low PH and Aluminum Toxicity on the Photosynthetic Characteristics of Different Fast-Growing Eucalyptus Vegetatively Propagated Clones. PLoS ONE 2015 , 10 , e0130963. [ Google Scholar ] [ CrossRef ]
- Lyčka, M.; Barták, M.; Helia, O.; Kopriva, S.; Moravcová, D.; Hájek, J.; Fojt, L.; Čmelík, R.; Fajkus, J.; Fojtová, M. Sulfate supplementation affects nutrient and photosynthetic status of Arabidopsis thaliana and Nicotiana tabacum differently under prolonged exposure to cadmium. J. Hazard. Mater. 2023 , 445 , 130527. [ Google Scholar ] [ CrossRef ]
- Narayan, O.P.; Kumar, P.; Yadav, B.; Dua, M.; Johri, A.K. Sulfur nutrition and its role in plant growth and development. Plant Signal. Behav. 2022 , 9 , 2030082. [ Google Scholar ] [ CrossRef ] [ PubMed ]
- Chen, J.; Duan, R.X.; Hu, W.J.; Zhang, N.N.; Lin, X.Y.; Zhang, J.H.; Zheng, H.L. Unravelling Calcium-Alleviated Aluminium Toxicity in Arabidopsis Thaliana: Insights into Regulatory Mechanisms Using Proteomics. J. Proteom. 2019 , 199 , 15–30. [ Google Scholar ] [ CrossRef ] [ PubMed ]
- Mariano, E.D.; Keltjens, W.G. Long-Term Effects of Aluminum Exposure on Nutrient Uptake by Maize Genotypes Differing in Aluminum Resistance. J. Plant Nutr. 2005 , 28 , 323–333. [ Google Scholar ] [ CrossRef ]
- Danyaei, A.; Hassanpour, S.; Baghaee, M.A.; Dabbagh, M.; Babarabie, M. The Effect of Sulfur-Containing Humic Acid on Yield and Nutrient Uptake in Olive Fruit. Open J. Ecol. 2017 , 7 , 279–288. [ Google Scholar ] [ CrossRef ]
- Salvagiotti, F.; Castellarín, J.M.; Miralles, D.J.; Pedrol, H.M. Sulfur Fertilization Improves Nitrogen Use Efficiency in Wheat by Increasing Nitrogen Uptake. Field Crops Res. 2009 , 113 , 170–177. [ Google Scholar ] [ CrossRef ]
- Shafiq, B.A.; Nawaz, F.; Majeed, S.; Aurangzaib, M.; Al Mamun, A.; Ahsan, M.; Ahmad, K.S.; Shehzad, M.A.; Ali, M.; Hashim, S.; et al. Sulfate-Based Fertilizers Regulate Nutrient Uptake, Potosynthetic Gas Exchange, and Enzymatic Antioxidants to Increase Sunflower Growth and Yield Under Drought Stress. J. Soil Sci. Plant Nutr. 2021 , 21 , 2229–2241. [ Google Scholar ] [ CrossRef ]
- Mariño Macana, Y.A.; de Toledo, F.H.S.F.; de Vicente Ferraz, A.; de Moraes Gonçalves, J.L.; Díaz López, S.M.; Barrero Cubillos, C.A.; Sierra Rojas, Á.N.; Bolognani, H.A. Soil Fertility and Fine Root Distribution after Gypsum Application in Eucalyptus Plantations with Different Tolerance to Water Deficit. New For. 2020 , 51 , 1039–1054. [ Google Scholar ] [ CrossRef ]
- Hussain, B.; Ma, Y.; Li, J.; Gao, J.; Ullah, A.; Tahir, N. Cadmium in Rice Is Affected by Fertilizer-Borne Chloride and Sulfate Anions: Long-Term Field Versus Pot Experiments. Processes 2022 , 10 , 1253. [ Google Scholar ] [ CrossRef ]
- Yan, S.; Yang, J.; Si, Y.; Tang, X.; Ma, Y.; Ye, W. Arsenic and cadmium bioavailability to rice ( Oryza sativa L.) plant in paddy soil: Influence of sulfate application. Chemosphere 2022 , 307 , 135641. [ Google Scholar ] [ CrossRef ]
- Nagayama, T.; Nakamura, A.; Yamaji, N.; Satoh, S.; Furukawa, J.; Iwai, H. Changes in the Distribution of Pectin in Root Border Cells Under Aluminum Stress. Front. Plant Sci. 2019 , 10 , 1216. [ Google Scholar ] [ CrossRef ]
- Yan, L.; Riaz, M.; Liu, J.; Liu, Y.; Zeng, Y.; Jiang, C. Boron Reduces Aluminum Deposition in Alkali-Soluble Pectin and Cytoplasm to Release Aluminum Toxicity. J. Hazard. Mater. 2021 , 401 , 123388. [ Google Scholar ] [ CrossRef ]
- Jaskowiak, J.; Kwasniewska, J.; Milewska-Hendel, A.; Kurczynska, E.U.; Szurman-Zubrzycka, M.; Szarejko, I. Aluminum Alters the Histology and Pectin Cell Wall Composition of Barley Roots. Int. J. Mol. Sci. 2019 , 20 , 3039. [ Google Scholar ] [ CrossRef ]
- Sato, M.; Nagano, M.; J In, S.; Miyagi, A.; Yamaguchi, M.; Kawai-Yamada, M.; Ishikawa, T. Plant-Unique Cis/Trans Isomerism of Long-Chain Base Unsaturation Is Selectively Required for Aluminum Tolerance Resulting from Glucosylceramide-Dependent Plasma Membrane Fluidity. Plants 2020 , 9 , 19. [ Google Scholar ] [ CrossRef ]
- Kochian, L.V. Cellular Mechanisms of Aluminum Toxicity and Resistance in Plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1995 , 46 , 237–260. [ Google Scholar ] [ CrossRef ]
- Tanoi, K.; Kobayashi, N.I. Leaf Senescence by Magnesium Deficiency. Plants 2015 , 4 , 756–772. [ Google Scholar ] [ CrossRef ]
- Filipovic, M.R.; Jovanović, V.M. More than Just an Intermediate: Hydrogen Sulfide Signalling in Plants. J. Exp. Bot. 2017 , 68 , 4733–4736. [ Google Scholar ] [ CrossRef ]
- Silva, G.S.; Gavassi, M.A.; Nogueira, M.A.; Habermann, G. Aluminum Prevents Stomatal Conductance from Responding to Vapor Pressure Deficit in Citrus limonia . Environ. Exp. Bot. 2018 , 155 , 662–671. [ Google Scholar ] [ CrossRef ]
- Kasajima, I. Difference in Oxidative Stress Tolerance between Rice Cultivars Estimated with Chlorophyll Fluorescence Analysis. BMC Res. Notes 2017 , 10 , 168. [ Google Scholar ] [ CrossRef ] [ PubMed ]
- Maina, J.N.; Wang, Q. Seasonal Response of Chlorophyll a/b Ratio to Stress in a Typical Desert Species: Haloxylon Ammodendron. Arid. Land Res. Manag. 2015 , 29 , 321–334. [ Google Scholar ] [ CrossRef ]
- Mathot, M.; Thélier-Huché, L.; Lambert, R. Sulphur and Nitrogen Content as Sulphur Deficiency Indicator for Grasses. Eur. J. Agron. 2009 , 30 , 172–176. [ Google Scholar ] [ CrossRef ]
- Howarth, J.R.; Parmar, S.; Jones, J.; Shepherd, C.E.; Corol, D.I.; Galster, A.M.; Hawkins, N.D.; Miller, S.J.; Baker, J.M.; Verrier, P.J.; et al. Co-Ordinated Expression of Amino Acid Metabolism in Response to N and S Deficiency during Wheat Grain Filling. J. Exp. Bot. 2008 , 59 , 3675–3689. [ Google Scholar ] [ CrossRef ]
- Alam, A.; Tariq, M.; Ali, J.; Adnan, M.; Fahad, S.; Ahmad, M.; Romman, M.; Saleem, M.H.; Okla, M.K.; Ahmad, S.; et al. Co-application of Phosphorus and Sulphur Improve Yield, Quality, and Nutrients Uptake in Nicotiana tabaccum L. Philipp. Agric. Sci. 2022 , 105 , 61–68. [ Google Scholar ] [ CrossRef ]
- Mittler, R. Oxidative Stress, Antioxidants and Stress Tolerance. Trends Plant Sci. 2002 , 7 , 405–410. [ Google Scholar ] [ CrossRef ] [ PubMed ]
- Sharma, P.; Jha, A.B.; Dubey, R.S.; Pessarakli, M. Reactive Oxygen Species, Oxidative Damage, and Antioxidative Defense Mechanism in Plants under Stressful Conditions. J. Bot. 2012 , 2012 , 217037. [ Google Scholar ] [ CrossRef ]
- Mittler, R.; Vanderauwera, S.; Gollery, M.; Van Breusegem, F. Reactive Oxygen Gene Network of Plants. Trends Plant Sci. 2004 , 9 , 490–498. [ Google Scholar ] [ CrossRef ] [ PubMed ]
- Lima-Melo, Y.; Alencar, V.T.C.B.; Lobo, A.K.M.; Sousa, R.H.V.; Tikkanen, M.; Aro, E.M.; Silveira, J.A.G.; Gollan, P.J. Photoinhibition of Photosystem i Provides Oxidative Protection during Imbalanced Photosynthetic Electron Transport in Arabidopsis Thaliana. Front. Plant Sci. 2019 , 10 , 916. [ Google Scholar ] [ CrossRef ] [ PubMed ]
- Sachdev, S.; Ansari, S.A.; Ansari, M.I.; Fujita, M.; Hasanuzzaman, M. Abiotic Stress and Reactive Oxygen Species: Generation, Signaling, and Defense Mechanisms. Antioxidants 2021 , 10 , 277. [ Google Scholar ] [ CrossRef ]
- Moustaka, J.; Ouzounidou, G.; Sperdouli, I.; Moustakas, M. Photosystem II Is More Sensitive than Photosystem I to Al 3+ Induced Phytotoxicity. Materials 2018 , 11 , 1772. [ Google Scholar ] [ CrossRef ]
- Zhu, D.B.; Hu, K.D.; Guo, X.K.; Liu, Y.; Hu, L.Y.; Li, Y.H.; Wang, S.H.; Zhang, H. Sulfur Dioxide Enhances Endogenous Hydrogen Sulfide Accumulation and Alleviates Oxidative Stress Induced by Aluminum Stress in Germinating Wheat Seeds. Oxidative Med. Cell. Longev. 2015 , 2015 , 612363. [ Google Scholar ] [ CrossRef ]
Click here to enlarge figure
Gene | Type | Sequence (5′->3′) | Tm (°C) | Product Size (pb) |
---|---|---|---|---|
26s proteosome subunit (26S) | Forward | TGCTTAGTTCCCCTAAGATAGTGA | 54 | 142 |
Reverse | CTGAGACCAAACACGATTTCA | |||
RuBisCO (RuBisCO) | Forward | TCATATCGAGCCTGTTGCTG | 60 | 144 |
Reverse | AGAGCACGTAGGGCTTTGAA | |||
Chlorophyll A binding protein (ChlAbp) | Forward | GCGCTCGGCCTATAATCTAC | 60 | 170 |
Reverse | AACACACCACCCGAAAGAAG | |||
Ferredoxin (Fered) | Forward | CGTCATCGAGACCCACAAGG | 58 | 93 |
Reverse | GGTGGCGATGCCCATGTA | |||
Copper–zinc superoxide dismutase (Cu/Zn-SOD) | Forward | CTCTTGCTAAGCTCATGTCC | 57 | 49 |
Reverse | TCCTGGACTTCATGGCTTC | |||
Iron superoxide dismu-tase (Fe-SOD) | Forward | GAAGCATCAGCAGGATCAC | 58 | 70 |
Reverse | GTTAACTACCGAGAGTTTCCTC | |||
Ascorbate peroxidase (APX) | Forward | GCTCTATCTGGTGGCCACAG | 57 | 82 |
Reverse | TCAGAGGATCACGGGTCCAT | |||
Glutathione reductase (GR) | Forward | TATCCGTCGTGGGTCTCAGT | 57 | 84 |
Reverse | GACAGACTTCTCCTGCCGTT |
Sulfate Nutrition (µM) | RuBisCO | ChlAbp | Fered |
---|---|---|---|
120 | 7.54 * ± 2.20 | 11.49 * ± 3.96 | 2.24 * ± 0.40 |
240 | 1.84 ± 1.09 | 1.17 ± 0.55 | 1.12 ± 0.15 |
360 | 1.54 ± 0.24 | 1.30 ± 0.20 | 0.26 * ± 0.02 |
Sulfate Nutrition (µM) | Fe-SOD | Cu/Zn SOD | APX | GR |
---|---|---|---|---|
120 | 1.69 * ± 0.26 | 0.86 ± 0.15 | 1.63 * ± 0.34 | 0.93 ± 0.16 |
240 | 1.27 ± 0.13 | 1.11 ± 0.11 | 0.98 ± 0.03 | 1.01 ± 0.03 |
360 | 0.47 * ± 0.12 | 0.60 ± 0.12 | 0.47 * ± 0.07 | 0.80 ± 0.07 |
The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
Share and Cite
Vera-Villalobos, H.; Lunario-Delgado, L.; Gálvez, A.S.; Román-Silva, D.; Mercado-Seguel, A.; Wulff-Zottele, C. Sulfate Nutrition Modulates the Oxidative Response against Short-Term Al 3+ -Toxicity Stress in Lolium perenne cv. Jumbo Shoot Tissues. Agriculture 2024 , 14 , 1506. https://doi.org/10.3390/agriculture14091506
Vera-Villalobos H, Lunario-Delgado L, Gálvez AS, Román-Silva D, Mercado-Seguel A, Wulff-Zottele C. Sulfate Nutrition Modulates the Oxidative Response against Short-Term Al 3+ -Toxicity Stress in Lolium perenne cv. Jumbo Shoot Tissues. Agriculture . 2024; 14(9):1506. https://doi.org/10.3390/agriculture14091506
Vera-Villalobos, Hernan, Lizzeth Lunario-Delgado, Anita S. Gálvez, Domingo Román-Silva, Ana Mercado-Seguel, and Cristián Wulff-Zottele. 2024. "Sulfate Nutrition Modulates the Oxidative Response against Short-Term Al 3+ -Toxicity Stress in Lolium perenne cv. Jumbo Shoot Tissues" Agriculture 14, no. 9: 1506. https://doi.org/10.3390/agriculture14091506
Article Metrics
Article access statistics, supplementary material.
ZIP-Document (ZIP, 679 KiB)
Further Information
Mdpi initiatives, follow mdpi.
Subscribe to receive issue release notifications and newsletters from MDPI journals
Food and Nutrition Security
Food and nutrition security crises will continue to erupt in the years ahead. While shocks cannot be avoided, particularly as climate change escalates, the severity of their impacts can be contained to prevent major setbacks in achieving long-term development goals. This requires being better prepared to respond swiftly when crisis risks first emerge and strengthening innovative efforts to build resilient food and nutrition systems globally.
Our goal is to build resilient food and nutrition systems that benefit people, the planet, and economies, while delivering timely and effective responses to mitigate crises. We work with governments to reassess market and price distortions, accelerate innovation through investment in research and development, enhance access to information and data analytics to reduce uncertainty and improve transparency, and scale up public and private investments. We are leaders in the global effort to get “back on track” to achieve the SDGs, particularly in fragile and conflict-affected situations.
The World Bank is a leader in strengthening global partnerships and national preparedness to build food and nutrition security. For over a decade we have hosted the Global Agriculture and Food Security Program , a fund dedicated to fighting hunger, malnutrition, and poverty. We lead international efforts to share information, and to rapidly provide resources where they are needed, while helping countries design the long-term reforms needed to build resilient food and nutrition systems.
This site uses cookies to optimize functionality and give you the best possible experience. If you continue to navigate this website beyond this page, cookies will be placed on your browser. To learn more about cookies, click here .
Skipping fresh fruit and veg due to the cost of living? Frozen produce can be a cheaper and more nutritious option
By Hanan Dervisevic
Topic: Diet and Nutrition
There is a misconception that frozen fruit and vegetables have less nutrients than fresh produce. ( Freepik )
As the cost of living crisis continues to bite, many Australians are looking to cut costs at the supermarket.
One victim may be fresh fruit and vegetables.
Data from the Australian Bureau of Statistics (ABS) shows fruit and veggie prices rose 7.5 per cent in the 12 months to July.
If you're looking to save a little money on fresh produce, there are other options to consider.
Opting for tinned or frozen food can be cheaper — and experts say they can be just as healthy.
Why is fresh produce more expensive?
Dietitian Alice Bleathman says fresh foods are generally more expensive due to several factors.
"Their perishability requires them to be sold and consumed quickly , necessitating higher costs for storage, transportation, and reduced shelf life," Ms Bleathman tells the ABC.
"The supply chain for fresh foods can be less efficient due to availability in crop yields, seasonal availability, and the need for careful handling to avoid spoilage and damage .
"Plus high demand for organic foods, driven by consumer preferences for 'healthier' options, also contributes to their higher prices."
But with frozen and canned products, the shelf life is long and manufacturers can control the process.
For mum of two Ash, buying frozen vegetables is both cost-effective and convenient.
"I've been living on a low income for a long time, and have learned that it's better to have a bag of vegetables in the freezer than fresh going rotten and being wasted in the fridge," Ash tells the ABC.
"I've had to be very selective about what I buy due to the cost of living.
"Utilising frozen vegetables allows me to have a stockpile for when money is tight so we never go hungry."
Can frozen produce be just as healthy or even better than fresh?
Fresh is often touted as being the most nutritious.
But this isn't always the case.
University of South Australia nutrition and food science director Evangeline Mantzioris says frozen food can sometimes be better for you than some products sold as "fresh".
"Organic nutrients in fresh produce can decline in transit from paddock to your plate, and even while stored in your fridge," Dr Mantzioris tells the ABC.
Evangeline Mantzioris says the old adage "fresh is best" isn't always true. ( Supplied )
Say you pick up some "fresh" oranges.
By the time that piece of fruit has been picked, transported and eaten, it may have lost some of its nutritional benefits — in particular, Vitamin C and B as they're susceptible to damage from heat, light and oxygen.
Ash says this is one of the deterrents for buying fresh produce.
"I try to do a weekly or fortnightly shop but fresh produce fails to last much past a couple of days so I'm often left with stuff I can't or don't want to use," she says.
"In this way frozen food is more cost effective in both the short and long term.
"It generates less food waste overall, so you don't need to go and buy a whole head of broccoli to only use a few florets before it's past its prime.
"That said, the options available are limited when compared to fresh, but overall I find it cheaper and easier to prepare nutritious meals for myself this way."
Frozen at peak ripeness
"Typically, fruit and vegetables are frozen shortly after harvest, preserving their nutrients ," Ms Bleathman says.
"Frozen produce can retain most of its vitamins and minerals, sometimes even better than fresh produce that has been stored for several days or weeks."
Research has shown that the nutritional value of fresh food versus frozen depends on the particular produce that's being frozen.
One study found that frozen corn, blueberries, and green beans have higher levels of vitamin C than their fresh equivalents.
Frozen green beans are $5.90 cheaper per kilo than its fresh equivalent. ( ABC Sunshine Coast: Kylie Bartholomew )
On the flip side, peas, carrots and spinach were lower in vitamin A in the frozen samples, while green beans showed no significant difference between the two storage methods.
Overall, that particular study found the vitamin content of the frozen produce was comparable to and occasionally higher than that of their fresh counterparts.
Dr Mantzioris says minerals such as calcium, iron, zinc and magnesium stay at similar levels in frozen and fresh.
What about canned goods?
Canned foods often get a bad rap, but they are a nutritious and cost-effective way to up your produce intake.
The biggest drawback is that the canning process often involves the produce to be partially cooked for preservation purposes.
"They heat the fruit or veggies to a high temperature to kill every microorganism such as bacteria and mould," Dr Mantzioris says.
"Because of this, you will have a breakdown of some heat-sensitive nutrients such as vitamin C."
Pick the option with the lowest salt content when you're choosing between types of tinned veggies. ( ABC News: Dannielle Maguire )
That's why experts recommend adding in canned produce towards the end of the cooking process to reduce the amount of nutrient loss.
But as with fresh and frozen food, different nutrients in different kinds of produce degrade at different rates.
What should I look out for when buying canned food?
Some canned fruit and vegetables can have a lot of sugar and salt added to them for preservation and taste purposes.
So, here are three tips from our experts when you're shopping for canned products:
- Choose "no-added-salt" or "salt-reduced" canned vegetables and beans
- Choose canned fruits in juice rather than syrup
- Look for the Health Star Rating on the front of the pack – the more stars, the better
They also recommend you drain and rinse canned vegetables and fruit before using them.
What about imperfect fruit and veg?
Australia's two biggest supermarkets sell produce that might not meet aesthetic standards but is still perfectly fine to eat.
The idea is that shoppers can save money by buying imperfect produce, and farmers are able to sell produce that would otherwise go to waste.
A 2024 comparison by CHOICE of major supermarkets found imperfect fruit and veg packs were on average 28 per cent cheaper per kilo than the cheapest alternative.
Meanwhile, Harris Farm Markets claims shoppers can save up to 50 per cent on imperfect produce .
A variety of consumption is better than none
What's most important is to have a diverse diet, says Dr Mantzioris and Ms Bleathman.
Dr Mantzioris pointed to a Bureau of Statistics survey that found only 4 per cent of Australians were eating the recommended serves of fruit and vegetables a day.
"Eat the fruit and veggies you love eating in a way that you can afford to buy them whether that be fresh, frozen or canned," she says.
Getting enough fruit and veg in to reach the recommended serving is what matters, Ms Bleathman says.
"Consuming a varied diet helps prevent nutrient deficiencies and reduces the risk of chronic diseases like heart disease, diabetes, and certain cancers.
"Additionally, a diverse diet promotes a healthy gut microbiome, which is crucial for digestion, immune function, and overall health."
If you're unable to load the form, click here .
COMMENTS
These are some of the best nutrition-related topics that you can ever come across. The impact of food safety in different institutions. Evaluation of nutrition in preschools for children. The positive and negative effects of training and nutrition on football players. The nursing habits of college-age students.
2 Interesting Nutrition Topics for Research Paper. 3 Research Topics in Nutrition and Dietetics. 4 Sports Nutrition Topics for Research. 5 Nutritional Responses to the COVID-19 Pandemic. 6 Advances in Food Technology and Biotechnology. 7 Emerging Topics in Nutrition and Health. 8 Innovations in Food and Dietary Patterns.
Examples of nutrition and dietetics thesis topic ideas: Promotion of healthy eating and physical activity: a qualitative examination of obesity interventions based ... Regional differences and associations with factors related to obesity in overweight and obese Americans. Post navigation. Previous. 11 Easy High School Research Paper Topics .
494 Nutrition Research Topics & Interesting Essay Titles on Food for Students. A wise man once said that your food can be the slowest killing poison or the most powerful and safest medicine. This adage underscores nutrition's supreme place in human health and life. Composing a paper on this topic can be of great value to you.
Best Nutrition Research Topics. Balancing Macronutrients for Optimal Health. Sugar's Influence on Obesity Rates. Vitamin D Deficiency: Consequences and Prevalence. Benefits of Probiotics and Gut Health. Ketogenic Diet and Cognitive Function. Childhood Obesity and Nutritional Interventions. Intermittent Fasting: Health Benefits and Drawbacks.
Theses/Dissertations from 2023. ASSOCIATIONS BETWEEN OYSTER CONSUMPTION AND IRON, ZINC, AND CADMIUM CONCENTRATIONS IN GHANAIAN WOMEN, Alyssa Abreu. ASSOCIATIONS BETWEEN STRESS, INTUITIVE EATING, AND ADIPOSITY IN A COHORT OF MIDLIFE WOMEN, Bridget A. Owens. POSITIVE FEEDING PRACTICES, TOTAL FRUIT INTAKE, TOTAL VEGETABLE INTAKE, AND OVERALL DIET ...
Assessing Self-Perceived Nutrition-Related Lifestyle Behaviors and Knowledge of University Music Students Following a Targeted Presentation, Gretchen Trumbo. Theses/Dissertations from 2020 PDF. Evaluation of Kentucky Grown Soft Red Winter Wheat with Sensory Evaluation for Bread-making Capabilities and Quality, Asa Conkwright III. PDF
Analysis of Weight-Related Advertisements and Nutrition Articles in Popular Women's Magazines, Jennifer Cardall Jacobson. PDF. Design and application of a nutrition education program based on a test of improved practices for pregnant women and women of childbearing age in La Rinconada and Cuambo, Odila Nicaragua. PDF
Researchers are now finding exciting connections between what we eat and how we feel. This article covers the latest trends in dietary studies, presenting over 200 fascinating nutrition research topics for college students. These areas look into the incredible potential of food to transform our health, our environment, and even how we think ...
Nutrition develops immunity system- This topic promises a lot of scope. There is an interdependence between Immunity system and nutrition and this provides a thriving ground for research topics. Enteral nutrition and inborn errors of metabolism. Nutrition: A treatment of multiple organ failure- Recent research has focussed on the breakdown of ...
200 Unique Nutrition Research Topics for Students of All Levels. Nutrition research holds immense importance in advancing our understanding of the link between food and health. A well-chosen research topic plays a pivotal role in this process, as it fosters curiosity, drives critical thinking, and contributes to the body of knowledge in the field.
Adaptive Eating Behaviors and Energy Intake: Coping Strategies and Their Impact on Health and Performance. Wilson Max Almeida Monteiro de Moraes. Caio Eduardo Gonçalves Reis. Ragami Chaves Alves. 214 views. A multidisciplinary journal that integrates research on dietary behavior, agronomy and 21st century food science with a focus on human health.
Nutrition Research Topics: Top 185+ Ideas. Nutrition is a branch of science that studies the impact of different foods and drinks on our bodies and their association with diseases, health, and our diet. It examines how nutrients in food supply energy and the physiological and biochemical processes involved in nutrient absorption.
Doctor of Philosophy (PhD) in Human Nutrition. Recent Dissertation Titles. Environmental enteric dysfunction in early childhood: bridging the gap between diet and stunting in randomized trial of complementary food supplementation in rural Bangladesh (2016). Evaluation of a pricing and communications intervention with food wholesalers and small ...
January 5, 2022 by ASN Staff. 2021 has come to a close, take a look back at some trending nutrition research articles from ASN's four journals: The Journal of Nutrition, The American Journal of Clinical Nutrition, Advances in Nutrition, and Current Developments in Nutrition. Here are 15 articles that were mentioned the most in news and social ...
50 Best Nutrition Research Topics to Write About. One of the first hurdles that students face when conducting a research project is coming up with a list of topics in nutrition that are original, interesting, and manageable. This list of 50 nutrition paper topics was compiled by our writing experts and is perfect for a variety of assignment types.
Potential nutrition research topics include the impact of diet on chronic diseases, food insecurity and its effects on health, the effects of certain nutrients on cognitive function, and the impact of nutrition on mental health. Richard Ginger is a dissertation writer and freelance columnist with a wealth of knowledge and expertise in the ...
Quality Nutrition Research Topics. The essence of nutrition in leading a healthy life. How a balanced diet helps to lower the risks of diseases in an organism. The process of energy production to the cells from food nutrients. The role of water, carbon dioxide, and sunlight in the process of photosynthesis in plants.
Topics in Clinical Nutrition (TICN) is a peer-reviewed, quarterly journal designed as a resource for the continuing education and clinical practice of dietitians and nutritionists. Each issue addresses topics of interest primarily to dietitians and nutritionists, students and interns in professional training programs and other health care personnel involved in the nutritional care of patients.
AUTHOR: In each respective box, enter your names (and/or initials) as they appear on the title page of your dissertation or thesis. You are the sole author; your advisor is not considered a co-author. Institution is University of Nebraska-Lincoln (not "at Lincoln" or ", Lincoln"). Do not leave this field blank.
Nutrition Related Dissertation Topics - Free download as PDF File (.pdf), Text File (.txt) or read online for free. The document discusses the challenges of writing a dissertation on a nutrition-related topic. It notes that such a dissertation requires extensive research, data analysis, and a deep understanding of nutrition as well as strong research and academic writing skills.
Video (online) Consult the top 50 dissertations / theses for your research on the topic 'Nutrition and dietetics.'. Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA ...
The pancreas plays a crucial role in nutrient digestion and assimilation. Along the continuum of pancreatic diseases, an ambiguous relation with nutritional status exists. While obesity is a known risk factor for severe acute pancreatitis and pancreatic cancer, inflammation as well as an impaired exocrine and endocrine pancreatic function put patients at an increased risk of malnutrition and ...
Food and nutrition is a broad and competitive field in the health area as it has a strong impact on the development and performance of the human body. If you are searching for an interesting topic for dissertation and research projects related to food and nutrition, we have developed a list of food and nutrition dissertation topics.
Fiddler has earned multiple awards from the American Society for Nutrition, including the Emerging Leaders in Nutrition Science (Vitamins and Minerals) in 2019, 2021 and 2022, and she was an ASN Postdoctoral Research Award competition finalist in 2021.
Al3+-toxicity in acidic soils is among the main abiotic stress factors that generate adverse effects in plant growth; in leaves, it affects several physiological parameters such as photosynthesis and ROS balance, leading to limited crop production. On the other hand, sulfur is a macronutrient that has a key role against oxidative stress and improves plant growth in acidic soils; however, the ...
Food and nutrition security crises will continue to erupt in the years ahead. While shocks cannot be avoided, particularly as climate change escalates, the severity of their impacts can be contained to prevent major setbacks in achieving long-term development goals. This requires being better ...
Topic: Diet and Nutrition. Sat 31 Aug Saturday 31 August Sat 31 Aug 2024 at 7:33pm. Display caption. ... Related topics. Australia. Consumer Finance. Cost of Living. Diet and Nutrition. Top Stories.